CX308541

Overview
NameCX308541
Unique NameCX308541
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length259
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig12941 contig Ccv1_Contig12941:1306..1564. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21001B04Rv AbsLeaSub1 Citrus clementina cDNA clone C21001B04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308541 ID=CX308541|Name=CX308541|organism=Citrus clementina|type=EST|length=259bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCAAATTGTAAAAAATCAG
CTTTATTCATTTTATTCGACACACCGTAGAAAGAAAAAAACAATCTGCAT
AGCAACAATCATATAACCCAAAAATGAATCATGTCTCAAAAGTCTCACTA
ACTCTATACCGCCATGTCTAATACAATAAACCCGCAACAATAACAAGGAA
ACTCGTAAATAAGCTAGCAGCGCCTAGAGACTTAGCGGAACTATTAGGCG
GAGGAGGTG
back to top