CX308544

Overview
NameCX308544
Unique NameCX308544
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length311
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX308544_ssr64 microsatellite CX308544_ssr64:64..75.
Ccv1_Contig392 contig Ccv1_Contig392:316..626. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21001B07Rv AbsLeaSub1 Citrus clementina cDNA clone C21001B07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308544 ID=CX308544|Name=CX308544|organism=Citrus clementina|type=EST|length=311bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGGGCCCTAAATTGGCATT
GTGAGTCATTCTATTATTTATTTATTGAAATGATTACGGGGGTCATTACA
GAAATATTCATGCCTCATAGTTTCTTCCATTCTTTCAAAACTACAAATAC
TTTGCCTTTCACAACACAAGGATAATCTTTACCCCAGAAGTATGATGCAT
AAGATATAACTAATTAACTATGCCCCCAACATGATGAAAACTAAAGCAAT
GGATTCAAATTAATCCAGGTGAACCGGTCGCTTCACTCCAACAATGATGC
AGCTCCCCCCG
back to top