CX308545

Overview
NameCX308545
Unique NameCX308545
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length627
Libraries
Library NameType
AbsLeaSub1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
CX308545_ssr203 microsatellite CX308545_ssr203:203..214. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21001B08Rv AbsLeaSub1 Citrus clementina cDNA clone C21001B08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308545 ID=CX308545|Name=CX308545|organism=Citrus clementina|type=EST|length=627bp
GCGGGGCTTACAAGACCGTTGTCGGTCTTTTGTCCCACTACTTCCGTTCC
GTTTCGTTTCCACCGACTCAAAATTTTCTCTTTTTCGTTTTTTTACTTTT
CTTCTCTTTCTCTCTCCTTAAAACACTCACACATTACGCATCGATACACA
TTAACGAAAACTACCATTGAAGCTGACGCTACCGTTGTTTCTAATCATTG
TCTTATTTATTTATTTTCTCAAAAAACTAGAAAAATTAAAAAAAATTTAA
AATGTATTCGATTAAAGAAAAAGTAACGGAGAAGCTATCCCGTCTCTTCG
CTGATTCTCCCAATAATTCCGTTTCTTCTCCCTACGACGATCCTCAGGCC
AGGTCATACTCTAAAGGGGGGAAATCCTTGACGTCATTTTTTTCCTTCAT
CAGCCCTTTGGCTAGTTCTGATGGATCTAAAACAAGCCAACAGCACCGTG
GACTTAAAAAACTTCGATCAATTCCTTGCAGACAAATTAGTGACGATTTT
GATCAGAAAATTGAACCCGCGGATATCTTTGAAGAATGCAGGACCGCATG
TAGCCCAGGTATACAGAATAATGAAAATAGTCCATTAAGCATGAACAAAG
CAGGTAGTGTTAGTGTTGATGATGATG
back to top