CX308546

Overview
NameCX308546
Unique NameCX308546
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length246
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig12941 contig Ccv1_Contig12941:1306..1551. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21001B09Rv AbsLeaSub1 Citrus clementina cDNA clone C21001B09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308546 ID=CX308546|Name=CX308546|organism=Citrus clementina|type=EST|length=246bp
TTTTTTTTTTTTTTTTTTTTTTTTTGTAAAAAATCAGCTTTATTCATTTT
ATTCGACACACCGTAGAAAGAAAAAAACAATCTGCATAGCAACAATCATA
TAACCCAAAAATGAATCATGTCTCAAAAGTCTCACTAACTCTATACCGCC
ATGTCTAATACAATAAACCCGCAACAATAACAAGGAAACTCGTAAATAAG
CTAGCAGCGCCTAGAGACTTAGCGGAACTATTAGGCGGAGGAGGTG
back to top