CX308581

Overview
NameCX308581
Unique NameCX308581
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length683
Libraries
Library NameType
AbsLeaSub1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig945 contig Ccv1_Contig945:1..683. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21001E08Rv AbsLeaSub1 Citrus clementina cDNA clone C21001E08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308581 ID=CX308581|Name=CX308581|organism=Citrus clementina|type=EST|length=683bp
TCGGATCCCTTTTCACTGTCACTCGTTTTTTCTACTTCAAAGGCTATGCT
ACTGGCGATCCTCAGAAACGCCTCGCTATTGGGAAATATGGATTCTTGGC
TTTGCTTGGACTTATGGTTTGCACAATTTCATTTGGGATCAATCAGCTTC
GAGGATAAACACTTGTAGTTCATCCTTTCTTTTGCATGGGACTCGCTTTC
CCTCTATCCATCTTTTTTATTCTCTATTTCTCTGGTAGCAGTTTTATGTT
TTTGTGTTGGTAGCAAAACTACATGCTGAAATTTTGTCAAAGTCCGTTGA
CATACTCTAATCACTTTGCTGCATGGCGCAAGCATAAGCTCATAGTTGAC
ACTGTTGTCATTAGAGCTTATTGTCATTACATAACGTGTAGTTTGGAAGT
ACATGATGAAAAATAATGGCATTAATTATATACAAGAGCATTCTCAGCTC
ATGCATTAATTCTACAGGAAATGATTATTATATGATAGATTGATAAGAGG
AGAGTGACATAGAGATATCGACATTAATTAGATGATGAAATTAATCAGCC
TAGATAATCAACTANTCATAGACAAGGAGCTAAGCAAAGACCCCTCTTCT
TGAGCTCTGTTTCATTATCTCTTCCATTAATGGAACCATCTCCCACTTCT
CTCTTCTACCCGACGAGCTGATGATGAGCCTCC
back to top