CX308589

Overview
NameCX308589
Unique NameCX308589
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length398
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21001F04Rv AbsLeaSub1 Citrus clementina cDNA clone C21001F04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308589 ID=CX308589|Name=CX308589|organism=Citrus clementina|type=EST|length=398bp
GCGGGGTTAAAAGAAGGCAAGTGTCCATAGGTTCTGGGTCTAAATCAAGA
GACAAAATTGTAATCGTGGAGGAGATAACGCCGGAGAATGTTCTTAATTC
CTTGGGAAAAGCCTCAAGTTCCTAATCTAGATGTGGAAATGAGAAATGTC
ATTTCTATATTCTTGACTTCCAAATGAAATGGCTGTATATATTCCAAGTG
AAGCTGAATCCAGGATTCATCCAAACAGTGGCTGTTCTGAGGATCAGGAG
ACTTCAACATGGGGTATTGCTCTTCGTTATCACCTACAAATAGTTATCTA
TACTCATTAGATTTGAAACTACAACAGCTGCAAGATAGTTTTGTTTTGTG
AATTATCGTCATAACTGCATGCTGTTCAAACAATATATACCTCAGTTT
back to top