CX308590

Overview
NameCX308590
Unique NameCX308590
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length264
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14808 contig Ccv1_Contig14808:124..386. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC21001F05Rv AbsLeaSub1 Citrus clementina cDNA clone C21001F05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308590 ID=CX308590|Name=CX308590|organism=Citrus clementina|type=EST|length=264bp
ACGAATGAACAAAATAATAATCGTAACAATAAAGCAAACTTTTGCATGGC
CAGTGGCTAATTAAAATATCCCCAGACTACCATTAATTCATGTCGCTTAA
GCACAAAATGGAACCCCATCAAACTAGCTTTTGCAGTTCCATTGATCACC
AAATTGAAGCTTTTGGTGATCATGAATCTGCGCCGGCCGATGAAACCTTA
GCAGAGTGACTCTTCTTTGACACCCACAAAAAACACCCACTTGGGATTTC
CTTTTCATCATCAG
back to top