CX308592

Overview
NameCX308592
Unique NameCX308592
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length276
Libraries
Library NameType
AbsLeaSub1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC21001F07Rv AbsLeaSub1 Citrus clementina cDNA clone C21001F07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308592 ID=CX308592|Name=CX308592|organism=Citrus clementina|type=EST|length=276bp
TTCAAGTGGAAGTGTTAGAAAAGTTCAACAGTATACCAGTAGTAACAAGT
CTGGATCTTGCTTGCTTTGCTGGAGCTGCATTACTTTCCTCAGCTTGCAT
ATTCCTTCTCTCAAGGCTTTCTGCTAGCATCACTGCTTCGTGGGATAGGT
ATGGTAGCACAGGGATATTGTTGGTTGGACATTAAAAACAAATCAAAAAG
GAAGTATACTGTATACATACCCCTAGGTTCTTCACTTTTCTAATCCTTTA
TACTTTCCCGCAAGTTCTTTTCTTCC
back to top