CX308596

Overview
NameCX308596
Unique NameCX308596
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length461
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14359 contig Ccv1_Contig14359:1354..1814. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21001F11Rv AbsLeaSub1 Citrus clementina cDNA clone C21001F11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308596 ID=CX308596|Name=CX308596|organism=Citrus clementina|type=EST|length=461bp
AGGATGCCACCGCCGATGAGGAAGGCGAGTATGAAGATGAGGAAGAGGGA
GAATTGGAGCATCATATTTGAAGAAGTTGTGTATGATGCATATTTGTCTG
TGTAGCTGGTTTTGTCAACCTTGCTTGGGATTGCAAAAAATGATCTATGA
TGTGTTATAGTTTTTCTTTCTCGAGTTTTTTACATCAAGTAGCAGTAAAG
TGAGTGATGGATGATGGGATCGATGAGGATCGACTATTGAGGATGGAGAA
ATTAAAGGATGGATGCATGTTTTGAAAGTAGTGGTGTGTGCTACCTTTAC
CTTGCTATCTATTCTGGATTTGATCTATTTTTGTATTCTATTATCCTTAG
CCATTGTCTTCTTATGTTCTGTGGTCGATGATGTTATTATGTTACTGTCT
ATTATGCCATAATGTGATATGCTATTTCTTTTCCTTGGCAAAAAAAAAAA
AAAAAAAAAAA
back to top