CX308597

Overview
NameCX308597
Unique NameCX308597
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length282
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig66 contig Ccv1_Contig66:265..546. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21001F12Rv AbsLeaSub1 Citrus clementina cDNA clone C21001F12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308597 ID=CX308597|Name=CX308597|organism=Citrus clementina|type=EST|length=282bp
TCTACTCTAGCGCCCTTTGGTGGCTTTGCCTTCATTGGAGCTTGGGCGAG
CTTGCTATTCTAAGGATTTGGTCTTTAGCTACGTCCTGTTGCTGCTTTGG
TATCAAACAGATGCTGAAGGAATTTATTGGCATCGGTCTCTTATCACTGT
TGCTTCTGGTCTATGATGTGTATTATTTAACTATATTTTAGTATGCTCGA
ATGCCTCTTGTGTAACTTAATGGCCCTGTTAATGTCATATTTATTCCCAA
TAAAGTCTGTTCGCAAAAAAAAAAAAAAAAAA
back to top