CX308601

Overview
NameCX308601
Unique NameCX308601
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length423
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig4938 contig Ccv1_Contig4938:502..924. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21001G04Rv AbsLeaSub1 Citrus clementina cDNA clone C21001G04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308601 ID=CX308601|Name=CX308601|organism=Citrus clementina|type=EST|length=423bp
GGTCGATGGCAAGGACCCTAGGGACCTGCAGCAGGAGATCACTGATGGTG
ATGTCGAAATTCCTCTTGATTGAAGACTCTGTTTGTGAGGGGGTCTATTT
TAGATTTTAATTTTTGTTTTTATCTCTATATATCAGTGCCTTTTTTTTTA
ATTATCAGTTTTGGATCTTTACAAGGATTTTGATGATGTCTCCAATTATT
CGAGCTTTAAACGAGTGCTTTATTATTGGAATTTAGGAGATGTAAGGTTT
AATTTAGTGGACTTATGTTGAATGATGCTTCAGAAAACGTATATTGGATC
TTTGAAATTTAAATTTTCTAATGCAAATGAATCTTGTTTATTTCGNAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCAAAAAAA
AAAAAAAAAAAAAAAAAAAAAGT
back to top