CX308858

Overview
NameCX308858
Unique NameCX308858
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length569
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21004F07Rv AbsLeaSub1 Citrus clementina cDNA clone C21004F07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308858 ID=CX308858|Name=CX308858|organism=Citrus clementina|type=EST|length=569bp
TTTTTTTTTTTTTTTTTTTTTTTGAAGTATGGACAACCAGATAAGTAATT
ATGTTAAAATAAAATCCATATGTCATGTTAATACAAAGATTTTGTTAGCT
GAAGAAACAAAAACGTAGATCGTGATTTTTTTTCTTCAGTAAAGATAAAG
AAACTTATATGGATTAACCATTGCGTTTTATTTTTGAAGCCATTTGGTAT
ATAACACAAGAGGCAAGGCCACTTGAGCCGGATTTGGCTTTCATATCAAT
ATTTTACAAACTAATTAAAGTAAGGAAGAGATAGGAAACAGTGAATCATT
TTTTATAGCTAGAAGCACACTATATTTATCAAAAGCTAATTAACGTGAAA
TTTGATCTGATCATCGCTTATTACCACATCGATCTTCTTCTTTTCCAGCA
CAATCCACGGATGAAATGCGTCGTGGATGCATCTTCTTACCCATCCATGA
GAAACAGCTACTAGATTTTTTCTCAGCTAAATCAGTCTCTTCCAGCTTGG
CTCCTTCTTCTTCCATTTTCTTCATTTTCTCCTTATGAGCTTTCCTTAGC
ACATATGCCTCAGCAATAT
back to top