CX308860

Overview
NameCX308860
Unique NameCX308860
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length385
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21004F09Rv AbsLeaSub1 Citrus clementina cDNA clone C21004F09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308860 ID=CX308860|Name=CX308860|organism=Citrus clementina|type=EST|length=385bp
TTAATTGACTCCTTTGCCAAATCATCGTTCAACCACAAAATGTGCTGACA
AATATTCTCCTCATCTTAAACTAGATACAGCAAAATTTCTTTGTAAAATG
AAATACAGTAAGCCTGACAATGCATCAGTTATGATCTAATGAATAGTCAG
ATCCTAATTATTTTTATTCAAAATTTATTAAAAAAAAAATTCTCTTCATC
ACGCAAAATTGATCCGCATGCACCTTTTACATGCAAAGAATGGCAACACT
TACTATTAAAAATACAGTAGTATGCAATAATTTATGCAGCAGCAGACTGC
TTTTCCTCATACTCATCAAGATTTAGAGCTTCCAACAACTTTGGCCAGGA
TTCTGGGATTCCTCCGGGTAAATCGAATTCCCCCG
back to top