CX308863

Overview
NameCX308863
Unique NameCX308863
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length245
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21004F12Rv AbsLeaSub1 Citrus clementina cDNA clone C21004F12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308863 ID=CX308863|Name=CX308863|organism=Citrus clementina|type=EST|length=245bp
TGATTACATTTATCCTTGCAATTGATGGGCTATATATTATGAGCATTTTA
TTCTGGATCTGTTTTGTATCTTTTTGGAGCCTTCAATTGATTTAGATATT
TAAATATTTTTTGTTCTTACTGATTAACAATGTGCCATTGCATTCTGAAT
TGATAATATCAATTTGCAATGTCGTTTGCTTATGAATGATACCTTGAATG
ATATATCATTTGTTATATATTAAAAAAAAAAAAAAAAAAAAAAAA
back to top