CX308865

Overview
NameCX308865
Unique NameCX308865
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length408
Libraries
Library NameType
AbsLeaSub1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC21004G03Rv AbsLeaSub1 Citrus clementina cDNA clone C21004G03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308865 ID=CX308865|Name=CX308865|organism=Citrus clementina|type=EST|length=408bp
TTTCCATCTGATCACATCCATCCCCCAAGCACTCAAGGGCCCTTGAAGCA
AAAGTTGCCCCTTCCTCTGCAAGATCAGGGTATTCCCCACAAATCTTTGA
TGCTATTAATAAAGCTGGAAGACACTTTGGATCCTCACTACCACTCAACA
GTTTCCTCAGAAGATTTAAAGCAACCAGGTCTTCACCTGCCCCATAATAA
CAGAGAGCTAGAATATGATATCTTTCTTTCCGATTAATTATCCCAGGAAG
TAATTCTTCAATTTGCGTAGCTAAAGAACTCAAGTCCCCCGCAATAGAAA
AAGCAAATGAAAGGTGGTCCAGGATTGATGGATCCCACTCAATTCTTTTG
AGAGCAACCTTTCTTAATAGTATCATTAACAGAAGTATGGCCTCTTCTAT
ATTGTTTC
back to top