CX308866

Overview
NameCX308866
Unique NameCX308866
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length205
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig980 contig Ccv1_Contig980:2..206. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC21004G05Rv AbsLeaSub1 Citrus clementina cDNA clone C21004G05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308866 ID=CX308866|Name=CX308866|organism=Citrus clementina|type=EST|length=205bp
TAAATTAATGTTGAGTCTAGTTGCCGATGGAAGGGCTTGGATTTGACTGC
TGCAAAATTCGGTGGTCACCTGCAGCCTCGGGAATTCCCATAGTATTAGC
CATTTCATAACCAAATCGTCTACCAAAAGAAATCGGTGTCGTTTTGCCCT
TTAAAACAGGAACCTTCATTGCCTCCATGCTCAAGATTTTTCTACCTGCA
CAAGA
back to top