CX308870

Overview
NameCX308870
Unique NameCX308870
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length422
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig360 contig Ccv1_Contig360:331..752. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21004G09Rv AbsLeaSub1 Citrus clementina cDNA clone C21004G09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308870 ID=CX308870|Name=CX308870|organism=Citrus clementina|type=EST|length=422bp
AGGGAAATTGTTGCCGATCGCATGTCTAAGGAAAAGACTAAGTTTATCAA
CGTGACAGTTTCCTTGACGAAAATTGGATGATCACTAAGATAAGACAATT
ATTAAGAAATAAAGCTTGAGAGGCATGTTAGCCTTTCCAATAATTTACCC
CAAGAAGATGCGTCCTCATTGATGTGCTTCAATATTGTGGATGGGAAAAT
GGGGTATTAAAAAATGTTCAACATCACCGTCCTCTTAATAAATGTTACAT
CACTCATTTGAGGTGCACATTTCAGGATAATATTTAGAATGTTTAATTAT
CATAGTTAATTCTATCACTCGTTGGTTTGAATATGTCAGTAAATTTTGGT
ATCAACAAGTGTCGGCATTAATACTGTATTCTCTTCGAATGAAAGAATTA
GTATGTGGCCCTTTGGTTTGTG
back to top