CX308871

Overview
NameCX308871
Unique NameCX308871
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length501
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig942 contig Ccv1_Contig942:1..501. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21004G10Rv AbsLeaSub1 Citrus clementina cDNA clone C21004G10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308871 ID=CX308871|Name=CX308871|organism=Citrus clementina|type=EST|length=501bp
AACGTTTTGATCCAAGCTGGAGGCTCAGCTAATTCTGTGTGCCACCATTA
CTCAATACATAATGTGTCTTTATACTCCCTTAATTTACGAATAAGATACA
GAATCCATGTATCAGTCCCCAAATGTTCACATTGGTCTATGTGGGCCATT
GATGGAACTTGCAACAGCATCGGCTAAAACTATGGTGAAGCTGGGATCTT
TAGTTAAGGATGCCACATATTCTTAAGTTACGAATAAGATACAGAATCCA
TGTATCAGTCCCCAAATGTTCACATTGGTCTATGTGGGGGGCCATTGATG
GAACTTGCAACAGCATCGGCTACAGCTATGGTGAAGCTGGGATCTTTAGT
TAAGGATGCCACATATTCTTCAATCTTCTTTTTATCGTCACAGACTTGCA
TCGAGTTTCTAGGGGGTCTAGTTTCTTGATTGGACCCAGATAGAGTAAGA
TCAAGTGTGACATCTGATCCAAAAGAATCAGTTGTTTGATAATCTGGGCA
A
back to top