CX308873

Overview
NameCX308873
Unique NameCX308873
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length227
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21004G12Rv AbsLeaSub1 Citrus clementina cDNA clone C21004G12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308873 ID=CX308873|Name=CX308873|organism=Citrus clementina|type=EST|length=227bp
GCGGGGGGGTATTAAAAAATGTTCAACATCACCGTCCACTTAATAAATGT
TACTTCACTCATTTGAGATGCACATTTCAGGATAATATTTAGAATGTTTA
ATTAGCATAGTTAATTCTATCACTCGTTGCTTTGAATATGTCAGTAAATT
TTGGCATCAACAAGTGTCGGCATTAATACTGTATTCTCTTCGAATGAAAG
AATTAGTATGTGGCCCTTTGGTTTGTG
back to top