CX308877

Overview
NameCX308877
Unique NameCX308877
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length230
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig11603 contig Ccv1_Contig11603:1221..1450. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21004H04Rv AbsLeaSub1 Citrus clementina cDNA clone C21004H04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308877 ID=CX308877|Name=CX308877|organism=Citrus clementina|type=EST|length=230bp
TTTTTTTTTTTTTTTTTTTTTTTTGAAGAAACACTTCATCTCATTTCCGT
AAGAAGGTTAACTCTTATTTTACATTGACTAAAATTGGAGAGAACAGAAA
AGGAGGCTAACAGCAAAAGGACTAGCATATCAGATTAAAAGAAAACTAAA
CTATTTTACATGGGTTGTCCATTTCGCCAAGGGAAACGTCAGGCAATTTA
CCACAATCATAACCAGTAACTTTATTACCA
back to top