CX309080

Overview
NameCX309080
Unique NameCX309080
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length232
Libraries
Library NameType
AbsLeaSub1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig881 contig Ccv1_Contig881:88..319. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21008C08Rv AbsLeaSub1 Citrus clementina cDNA clone C21008C08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309080 ID=CX309080|Name=CX309080|organism=Citrus clementina|type=EST|length=232bp
AATTAATTTGAGTATACGCTGGCTAGGGTCTCCAAGTGCAACATCTATCC
CATATTTATTTAATAACCTAGAAGCAATCCAAGTCGTCAAACTGAAAATT
TGGGTCCAAATCTTCCTCTGTAAGCGAGAAATCAAAGTCCCCAAATGGTG
AGTTGATGACTGAAGTTGGAGTTGAAATTATCTCAGCTTTGAGATCAGAC
TCCGGAGTTTGCACATCGTAGCCAAGTCCCCG
back to top