CX309081

Overview
NameCX309081
Unique NameCX309081
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length422
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21008C10Rv AbsLeaSub1 Citrus clementina cDNA clone C21008C10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309081 ID=CX309081|Name=CX309081|organism=Citrus clementina|type=EST|length=422bp
ACACAAACCAAAGGGCCACATACTAATTCTTTCATTCGAAGAGAATACAG
TATTAATGCCGACACTTGTTGATACCAAAATTTACTGACATATTCAAACC
AACGAGTGATAGAATTAACTATGATAATTAAACATTCTAAATATTATCCT
AAAATGTGCACCTCAAATGAGTGATGTAACATTTATTAAGTGGACGGTGA
TGTTGAACATTTTTTAATACTCCATTTTCCCATCCACAATATTGAAGCAC
ATCAATGAGGACGCATCTTCTTGGGATAAATTATTGGAAAGGCTAACATG
CCTCTCAAGTTTTATTTCTTAATAATTGTCTTATCTTAGTGATCATCCAA
TTTTCGTCAAGGAAACTGTCACGTTGATAAACTTAGTCTTTTCCTTAGAC
ATGCGATCGGCAACAATTTCCC
back to top