CX309082

Overview
NameCX309082
Unique NameCX309082
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length339
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21008C11Rv AbsLeaSub1 Citrus clementina cDNA clone C21008C11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309082 ID=CX309082|Name=CX309082|organism=Citrus clementina|type=EST|length=339bp
ACGGACGGTGGACACTAAGAAATATAATCTCTTGTATATCAAGAGATTTT
ACAGGTTGAACTGAACTAAACTGACCCTCACACAATTAATTGACAGGTAA
TAACAATACCCATCCTTTTATTAACCATAATAGAAAAGAGTAATACTGTG
TGCCCTCACACAATTAATTGACAGGTAATAACAATACCCATCCTTTTATT
AACCATAATAGAAAAGAGTAATACTGTGTGCGTGCATGGGCTTATTAACC
GGTGTGGTCGGGATTTCTTCCATATTGAGGGACAACAATAAGATCAAGAT
TATCAATTGTCCCGTCCTTATCGTCAGCAATACCATAGA
back to top