CX309083

Overview
NameCX309083
Unique NameCX309083
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length288
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21008C12Rv AbsLeaSub1 Citrus clementina cDNA clone C21008C12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309083 ID=CX309083|Name=CX309083|organism=Citrus clementina|type=EST|length=288bp
AGCCCTTTAAAGCCTACATTACACTTACTCACTAAAGCACCAATCCAGAT
GTAACCGCAAAAATCCATCTGGAAACTTAGGCCATTCATCCATAAATTGA
TTCAATTCGTCAGAATTAAGCATAGGACCTCCAAACTGTTTGAAGCTCTC
AATCTTTGCATCCATTAAATAATACCGCCAGCTTTTGATATCATCAGAAT
TGCAATTTTTCAATTCTGGATTTCGCAAGTAGTCATAAAGCCACACAATG
AATGGGTGTTGCTCCTCATACATGGTAGACAAACCCCG
back to top