CX309084

Overview
NameCX309084
Unique NameCX309084
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length554
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21008D01Rv AbsLeaSub1 Citrus clementina cDNA clone C21008D01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309084 ID=CX309084|Name=CX309084|organism=Citrus clementina|type=EST|length=554bp
TTTTTTTTTTTTTTTTTTTTTTTTTTAAATTGAAAGCATATGATTTATTT
CCATAAGCACCAAGATTCCTACAATAAAGATAAACCAATACATCTCTTTC
TCTCCCATATGATTTGTTTTTAAAAATAATGAAGAAAAAGAAGAAATACA
AATAATAAATTAATTGGGTCCCCAGCAAATTAGGTGGAAGAGCATCTCAG
CCTTCTCTTGTTGCCTCCTCTTTTTCTTGATCTGGTCTCCATTAACCCTC
TTGATACCCTGATTGTTGTTATTAATATTATTAACGCCACCAGCAAGACT
CGTTACAATAGAATTATTGTTGCCCTTATTATAGCCACAAGATTCTTGCA
GCACATACTTGGTGAATGCTGAATCAAACTTGCAAACTCTGCCACCGTAG
CTGCTCATGTCTCTTACTACACTGTCCTCACCCCAAATACTTGTTTTAAT
GATTATAAACGATAAAATATTCAGTTGGGTGCTGGAAGGAAAATTGATCG
GCAACTTATAGAGTAGAGAGGTTGTTGAGTTCTTGGACTTTTAAGTGACC
CCCG
back to top