CX309087

Overview
NameCX309087
Unique NameCX309087
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length235
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21008D04Rv AbsLeaSub1 Citrus clementina cDNA clone C21008D04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309087 ID=CX309087|Name=CX309087|organism=Citrus clementina|type=EST|length=235bp
TGGACGAAGAGTCTCTTGAAGTTGATGACGATCTCAAATAAAGCTGTCTT
GTGATATTATCTTTTTCTTCTGAGTGGTTTAAGCTCGCCTTCTCCGCGTC
CGAGAATGAAGTTTCAGCTTTTGAAATCATGAAAGCCATTTCTTTGTTTA
ATTGCAAGAAATTGTGTGTGTCACTATGGAGAAATCAGAGATATAGCTTA
CCAGGAAGTGAGATAACTTACTTCGCATATCCCCG
back to top