CX309090

Overview
NameCX309090
Unique NameCX309090
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length256
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21008D09Rv AbsLeaSub1 Citrus clementina cDNA clone C21008D09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309090 ID=CX309090|Name=CX309090|organism=Citrus clementina|type=EST|length=256bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAAAATGGCAAACTAG
ATAGAACATAAAACATCAACAAACAACATCTTAAGGAGCTCAACAGAGAC
CTAAAACTCCTGAGCTGCTTACAAAATATCCAAGTTTGAACATGACATGG
ACAACAAAAATAGACTCAATACAGTAATCTCGCCACCGCCGATCAAGAAC
CCAGTTCTGTGAACAAAAGTCTCTTGTCGATGGTGACGAATTGTAATTAT
AACCCG
back to top