CX309091

Overview
NameCX309091
Unique NameCX309091
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length263
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14808 contig Ccv1_Contig14808:124..386. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC21008D10Rv AbsLeaSub1 Citrus clementina cDNA clone C21008D10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309091 ID=CX309091|Name=CX309091|organism=Citrus clementina|type=EST|length=263bp
AAGAATGAACAAAATAATAATCGTAACAATAAAGCAAACTTTTGCATGGC
CAGTGGCTAATTAAAATATCCCCAGACTACCATTAATTCATGTAGCTTAA
GCACAAAATGGAACCCCATCAAACTAGCTTTTGCAGTTCCATTGATCACC
AGATTGTAGCTTTTGGTGATCAGAATCTGCGCCGGCCGATGAAACCTTAG
CAGAGTGACTCTTCTTTGACACCCAGAAGAAACACCCACTTGGGATTTCC
TTTTCATCATCAG
back to top