CX309093

Overview
NameCX309093
Unique NameCX309093
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length375
Libraries
Library NameType
AbsLeaSub1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC21008E02Rv AbsLeaSub1 Citrus clementina cDNA clone C21008E02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309093 ID=CX309093|Name=CX309093|organism=Citrus clementina|type=EST|length=375bp
GCGGGGAAATTTTTCAGAGTCTGAACTACAAAGGGTTTTTGATATCTTCC
GGGATGTGTTGGTTGGTTATTTTGATAGTAAAAAATCTCAAGTTAAATCT
GAATTTCTGAAGGAAATATTTCGAAGAAGGCCATGGATTGGGCATCATCT
CTTTGGATTCATTCTTGAAAAATGTGGCAGTGCAAAATCAGTGTTTCGTC
GAGTTGAATCTCTGGATCTGGTGATGGAGATTTTAAAGTCACTGGTTCCT
TTAAGCTCTGATGAAGCTACTCGGGATGCATCAAAGAGAAAGTTGGAGAG
CCATCTCCGAAATCTCAGCCATGTGATAAAGCAGTTGGTGACAAATATGC
CTGAGAAGCAGTCTAGACGGGCTGA
back to top