CX309100

Overview
NameCX309100
Unique NameCX309100
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length167
Libraries
Library NameType
AbsLeaSub1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10600 contig Ccv1_Contig10600:1032..1198. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21008E10Rv AbsLeaSub1 Citrus clementina cDNA clone C21008E10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309100 ID=CX309100|Name=CX309100|organism=Citrus clementina|type=EST|length=167bp
TTTCCGTAATCATTGTCCCTCCGGCTGTTCCTGAACGCACAGCAGCCAAT
GGAGTAAACGATGATAAGTACTATGAGGAAGACAATGTTGACAATGGCAA
CCTTCTTCCAGTCACTCTTGAGTTGGTCCAGCAGGCCAGCCTTGCATGAT
TGGCAGTTGTAGCACAA
back to top