CX309101

Overview
NameCX309101
Unique NameCX309101
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length394
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig979 contig Ccv1_Contig979:1..394. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC21008E11Rv AbsLeaSub1 Citrus clementina cDNA clone C21008E11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309101 ID=CX309101|Name=CX309101|organism=Citrus clementina|type=EST|length=394bp
GCGGGGGTCCTTTTCTCTCGTTACCGCAGCCTCAGTAAAGCGATTAGGGT
TTGAATTGAAGAAGCCAGTTTCGGAAACTTCTCACCATGAGAGCTAAGTG
GAAGAAGAAGCGTATGAGGAGGTTGAAGAGGAAGCGCCGAAAGATGAGAC
AGAGATCCAAGTAGTCTTATTCCTTAGTGCGGCGTCGTTTTTTAGCTATT
TTGTTGCTTTGTTGTTTTGCCTATCAATTAGTGATTTTGATGTTTTAATT
TCATGTTTTAATACATTTTGTTGATTCCAGTGAATCACTTTATTAGCTCT
AAATGGGATTATGTTTTGCTTATTCAGAATCAANAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAGCCAAAAAAAAAAAAAAAAAAAAAAAAA
back to top