CX309103

Overview
NameCX309103
Unique NameCX309103
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length262
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig4535 contig Ccv1_Contig4535:284..545. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21008F01Rv AbsLeaSub1 Citrus clementina cDNA clone C21008F01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309103 ID=CX309103|Name=CX309103|organism=Citrus clementina|type=EST|length=262bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTCAAGCAAAAACCAAATGCTCATT
CACGTTTAAATAGAACGGCACAAAATGCCATTGTAAATAATTCATACAAG
TCAAAATTTCATAAGAAAATTAAAACTGCAAAACAAAAGCTGCTGTCTCA
ATTTAACTCTTAAATGCTAGCTTTTCTTTGGCCTTCTGAATCTTCAGCAC
TTTCTTGACAATCTTCTGCTCCTCCACCAAAAAGGCCCGGATAATCCTCT
CCCTGACACCCG
back to top