DY257709

Overview
NameDY257709
Unique NameDY257709
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length393
Libraries
Library NameType
AbsCOv1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9896 contig Ccv1_Contig9896:8..400. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAB1AA02ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257709 ID=DY257709|Name=DY257709|organism=Citrus clementina|type=EST|length=393bp
GGCTCAAGCACAGCTTCTTTTCTTTTGAGTTTTGAATACGGTTCAGTCGA
AGCCAGCAGAAATCTTTTGCCTTCCTGATTTGAAGATTATGGGAACTCCT
TGCGCAGGTTATACCGATTGGTCGGAGGGTGGGGCCCCCCCATGGTTTTC
ACTTATTGCTGATGATGAAATTAATGGAAATATTGATCTTCTTGTAGTCC
CACAATATGGAAGAAACCCTGATCACACTGGTTAAGAATATGCAGTATTA
GTCTCTTATGTTATGTTTAAGAAAATAAAAGTATGGGTACTGTTATTACC
CGTCAATTGTACGATGGTCTCAGTTTGGTTCAGTTTAACTTGTAAGATCT
CTTGATATATACAAGAGATTCTCTTTGTCTAGCTAAAAAAAAA
back to top