DY257710

Overview
NameDY257710
Unique NameDY257710
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length256
Libraries
Library NameType
AbsCOv1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10178 contig Ccv1_Contig10178:315..570. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAB1AA08ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257710 ID=DY257710|Name=DY257710|organism=Citrus clementina|type=EST|length=256bp
ATTAGATAAATCTGTTTTTGCATCAAAATCTCGCAATTATCCCCAGTGGA
TGAATTTTTGACCATCTAGATGAGAAATTCAAATTGCACTGAAAATTATG
CAGTAGTTTACCAATAGGAGAGCATTATTCAGTGGTTAAAAACTGTACCT
TTTGTTGGGACCGCGGGGTACCAGGAATTTTTGTCCTGATTTTGGACTGT
TACCAAATTTTCTTATGCAATAAGAATTTTCCAGATTCCAATTTAAAAAA
AAAAAA
back to top