DY257713

Overview
NameDY257713
Unique NameDY257713
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length166
Libraries
Library NameType
AbsCOv1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig1944 contig Ccv1_Contig1944:152..317. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAB1AB08ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257713 ID=DY257713|Name=DY257713|organism=Citrus clementina|type=EST|length=166bp
AAATATTTAATTTTGGGTAAAGGTGGACTACAATACTGGGAGGACGATAT
ATATAATTAAATAAAAAGATGGGTACAGTTATAACCTATCAATTATAAGA
GTGTCAATTTAATTCAATTCACTTACAAAAATCTCTTATAAAAGAGATTA
TCTTTGTTTGCGTTCA
back to top