DY257716

Overview
NameDY257716
Unique NameDY257716
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length340
Libraries
Library NameType
AbsCOv1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9875 contig Ccv1_Contig9875:47..386. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionKN0AAB1AC06ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257716 ID=DY257716|Name=DY257716|organism=Citrus clementina|type=EST|length=340bp
GGTTCAGTCGAAGCCAGCAGAAATCGTTTGCCTTCCTGATTTGAAGATTA
TGGGAACTCCTTGCGCAGGTTATACCGATTGGTCGGAGGGGCTTATAGCC
ACAACTTTTTCACTTATTGCTGATGATGAAATTAATGGAAATATTGATCT
TCTTGTGGTCCCGCAATATGGAAGAAACCCTGATCACACTGGTTAAGAAT
ATGCAGTATTAGTCTCTTATGTTATGTTTAAGAAAATAAAAGTATGGGTA
CTGTTATTACCCGTCAATTGTATGATGGTCTCAATTTGGTTCAATTTAAC
TTGTAAGATCTCTTGATATATATAAGAGATTCTCTTTGTC
back to top