DY257717

Overview
NameDY257717
Unique NameDY257717
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length412
Libraries
Library NameType
AbsCOv1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig1025 contig Ccv1_Contig1025:1..412. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAB1AC07ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257717 ID=DY257717|Name=DY257717|organism=Citrus clementina|type=EST|length=412bp
ATTGAGAATTTCTTGTTGATTGCGCTAGGAAGGTTGGGGTGGAAGGGGCA
GCAGAATTTCTTGACGAACCCAACAATGGATTGAGTGAGGTTCATGAGGA
GCTGAAGAACTACTCGGCAAACATTTCAGGCGTTCCTCATTTTGTGCTTA
ATGGAAAGCATGAGTTGAGCGGTGGTCAACCCCCGGAGGTTTTCCTAAGA
GCTTTTCAAGTTGCTGCTAACTGAAATTACTTGCAGCATGAAGCTTCTAT
GTTCAGTCTTCAATAAGGATGCTTCTGCTTTTGTGGATTGTCGGCTTAAA
ACCATAATCTCTCTTATTATGCTAGCGTGTTCTAATACCTTGAAACTGGT
TTGTAAATTATATAACAAATGTTCAGATGAAATAAAAGTTAAGGCTTGTT
GATTGGGGGGTC
back to top