DY257719

Overview
NameDY257719
Unique NameDY257719
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length687
Libraries
Library NameType
AbsCOv1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig1026 contig Ccv1_Contig1026:1..687. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAB1AC11ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257719 ID=DY257719|Name=DY257719|organism=Citrus clementina|type=EST|length=687bp
GCGGGGGCCTTCGGGTGTTAGAGATTATGAAACTAAGAAAGAAATTTTGT
TAGAGATTATGAAACTAAGAAAGGCATCTACGGCACATAGGAGAGATTTC
TAAGTTGCAATTTGACTATATTGCAGGCATATAAACTCTACAAGAAAGAC
AAAAGCTTGGAGATTGTAGACCCCAGTTTAGCAGCATCAGATTCTGGTGA
CCAAATAGCAATGTGTATCCAAATAGGATTGTTATGCACACAAGGTGACC
CCCAGTTGCGGCCAACTATGAGACGTGTAGTCGTGATGCTATCAAAGAAA
CCTGGCCCTGGCAATCTAGAAGAGCCAACTAGGCCTGGCGTGCCAGGTTC
AAGATACAGAAGAGCTAGAAGACCGGCAGCATTGTCATCATCAACTGCCG
GAAGCTCCGGTGAATCCAATTCCCGTACATACACTTCAAGCTTAAATACA
AATACTGGCACTGCTAGTGCCTCTACATCAGCTCTTGCAAGCCCAAGACA
GGACAAGCGTGGGAAACGTCCGGTGGAGAGTTGGGATTAGATGTAGTGTA
GAAAAATTTTGGTTATCCTTTTGTGATATTTCGTATATTATTTGATTGTG
TATACCAAAGCCGAGTTGTAGCCTCACGTTATAAATGAAAAATGGCGTCA
TCATTGAAATTAATAATAAATCATTTGTGCTTANNNN
back to top