DY257720

Overview
NameDY257720
Unique NameDY257720
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length679
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB1AC12ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257720 ID=DY257720|Name=DY257720|organism=Citrus clementina|type=EST|length=679bp
GACCCCACACACACGCCTCACCACTCCCTCACCTCACCCGTCCTCTTCCT
GTTCCACGGCCATCAATGGCGGTGCGAGTCGACAACAATCAACTGCGGCG
GCTGATCTTCGTCTCCGGTAACGATTAACGACGGCGCAAGCACAGCTGAT
CTGTGCGCTAGCTCAAGCTTGGCCGATCTGTTGCTTGCTCGATTACTCTT
CCTATATTCACTCAGAGTCAACTGTTTGACAAGAGTCGAAGTCCAAGTTA
TTTTTTAATTGAAGTTTTAATTTAATTTTTATTTTTTAACTTGGTTTAGA
ACATAAATTCATTCTTTAATTTTGATTTTCTGAGAAGTTAATGAATATAT
AATGAAACTATGTGTCTCAAATTGAGGTCGGGCATGTTTATATTTGCGTA
ATCTGGATACAGGAACCGTTTCAAATAAATTCAAGGTGCAAGTATCTCCG
TGTTTTAGTCGACACTAAAACCCCTGCTGACTTCAAGTGGCTCCCTTGAA
TTGGCAATTGGATTTGCTCTGGTTGTGACCATTTTGAAGAGTAACAGGTC
ACTCTACATATAAGTCTTCTGAATTTAAAGTATGGTAGGAAAAAGACAGT
CTCCCAGCATTTCTCTATTTGAATTTTCTTTTTAGTCCAGTGCTTCTAGC
AATTTTTATAATAATGCCTTTCCATTGAG
back to top