DY257722

Overview
NameDY257722
Unique NameDY257722
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length862
Libraries
Library NameType
AbsCOv1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9893 contig Ccv1_Contig9893:4..865. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of DY257722 vs. ExPASy Swiss-Prot
Match: SKIP5_ARATH (F-box protein SKIP5 OS=Arabidopsis thaliana GN=SKIP5 PE=1 SV=1)

HSP 1 Score: 381.333 bits (978), Expect = 3.718e-105
Identity = 190/266 (71.43%), Postives = 218/266 (81.95%), Query Frame = 1
Query:   31 EEKINSERSTKRFKSKTMKNNSFIAPINNLDDGCLMHVFSFLSPIPDRYNTALVCHRWNYLACHPRLWLRVDQSVKDLSKPGVFPDLKTAVSVARPGDTILIAAGGSHPVSNIQIKKQLCLVGGGELPDETTLICSRGSDSALEFLSTCKLANLTVRAELGCCLLHRSGRLTIDGCVLQCETNPLDFLSCPIVSTA-----RSCITSTPMKS------NGDSVTVLHTRIEGGAKAVLTSGDLVLQRVRVIYARTYLYFWFDVDHQ 795
            + K + ER  +    K MK  S +  +NNLDDGCLMH+ SFLSPIPDRYNTALVCHRW YLACHPRLWLRVD+ VKDLS+PGVF ++++AVS ARPGDTILI AGG++ VSNIQIKK LCLVGGGE+PDETTL+C+RGSDSALE LSTCKLANLTV+AELGCCLLHRSGRLTIDGCVLQCETNPLD LSCPIVSTA      + ++   +K         +SVTVL TRIEGGAKAV T GDLVLQRVRV+Y++ YLYFWFDVD++
Sbjct:   10 DNKKHPERIVESKMKKRMKPYS-LTSLNNLDDGCLMHILSFLSPIPDRYNTALVCHRWRYLACHPRLWLRVDRFVKDLSQPGVFLNIESAVSAARPGDTILIVAGGNYRVSNIQIKKPLCLVGGGEIPDETTLVCARGSDSALELLSTCKLANLTVKAELGCCLLHRSGRLTIDGCVLQCETNPLDHLSCPIVSTAGDEDIENILSHVEVKETVTGKIKANSVTVLQTRIEGGAKAVSTRGDLVLQRVRVMYSKAYLYFWFDVDYE 274          
The following BLAST results are available for this feature:
BLAST of DY257722 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 1
Match NameE-valueIdentityDescription
SKIP5_ARATH3.718e-10571.43F-box protein SKIP5 OS=Arabidopsis thaliana GN=SKI... [more]
back to top
Properties
Property NameValue
Genbank descriptionKN0AAB1AD02ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257722 ID=DY257722|Name=DY257722|organism=Citrus clementina|type=EST|length=862bp
GGACTTGGAGTTTGTGAACAAATGGAAGATGAAGAGAAGATAAACAGTGA
ACGAAGTACTAAACGATTCAAAAGCAAAACTATGAAAAATAATTCTTTTA
TTGCTCCAATAAACAATCTTGATGATGGCTGCCTTATGCACGTATTCAGC
TTCTTATCCCCAATTCCAGATCGGTATAACACCGCACTCGTTTGCCACAG
ATGGAATTACTTGGCATGTCATCCTCGCTTGTGGCTGCGGGTAGATCAGT
CTGTTAAGGATCTCTCAAAGCCAGGAGTTTTCCCCGACCTTAAGACAGCC
GTATCTGTGGCAAGACCGGGCGACACCATTTTAATTGCAGCAGGCGGTAG
TCATCCTGTCTCTAATATTCAGATAAAAAAACAACTGTGCCTGGTCGGAG
GAGGTGAGCTTCCTGATGAAACAACCCTTATCTGTTCTCGAGGTTCGGAC
AGTGCCTTGGAGTTTCTATCCACGTGCAAGCTGGCGAATTTAACAGTGAG
AGCAGAGCTTGGCTGCTGCTTGCTCCATCGGAGTGGAAGGTTAACTATAG
ATGGGTGTGTACTTCAGTGTGAGACGAATCCACTGGACTTCCTCTCATGC
CCAATCGTGAGTACAGCTCGTAGCTGTATTACATCTACTCCAATGAAGAG
TAATGGTGATAGTGTTACTGTTTTGCATACTCGAATTGAAGGAGGTGCCA
AGGCTGTTTTGACTAGTGGAGATCTAGTGCTGCAGCGAGTTCGAGTTATA
TATGCCAGGACTTATCTGTATTTCTGGTTCGATGTAGACCATCAATGAAA
ACTGTATTCTCATTTTTATGTAACATTTTCCACTGTTTGCAAAGTTACTG
CTGATTTCTCAT
back to top