DY257724

Overview
NameDY257724
Unique NameDY257724
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length353
Libraries
Library NameType
AbsCOv1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9895 contig Ccv1_Contig9895:4..356. BLAST: Citrus Unigene V1 Contigs to Populus V2 proteins
Properties
Property NameValue
Genbank descriptionKN0AAB1AD05ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257724 ID=DY257724|Name=DY257724|organism=Citrus clementina|type=EST|length=353bp
GTGAGAAATTTTTTGGTGGAACAGATGGCTTCTTCATTGACAAAAGATCC
TAATTTTACGACGGCGCTGGCTGCGGCAATTTCTGGGAAAATATTTCAAC
ATAATCCGAGAGAGAAATGGTGAACTTCATTAGAAGATTGCATGAGTGTT
CTGCTGTTTCTTTCTTTTTTCTTTTTTTCAAATTAGGAATTTAGGCTGCT
GTGAGATTTAGGATGTCTTTGTAAATACAGCATTGTAAAGGGAAAAAGAA
AAAGGAAAATTCCCAAGATTAATTTTTGAGTCTTATGTAAAGTCAGAGGG
AAACAGAAAATTTTCCTCTGCTTCAATATCAAAAATTGGAGCTCCACGGC
CCC
back to top