DY257725

Overview
NameDY257725
Unique NameDY257725
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length383
Libraries
Library NameType
AbsCOv1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9896 contig Ccv1_Contig9896:4..386. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAB1AD06ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257725 ID=DY257725|Name=DY257725|organism=Citrus clementina|type=EST|length=383bp
GGCTCGCTCAAGCACAGCTTCTTTTCTTTTGAGTTTTGAATACGGTTCAG
TCGAAGCCAGCATAAATCTTTTGCCTTCCTGATTTGAAGATTATGGGAAC
TCCTTGCGCAGGTTATACCGATTGGTCGGAGGGTGGGGCCCCCCCATGGT
TTTCACTTATTGCTGATGATGAAATTAATGGAAATATTGATCTTCTTGTA
GTCCCACAATATGGAAGAAACCCTGATCACACTGGTTAAAAATATGCAGT
ATTAGTCTCTTATGTTATGTTTAAGAAAATAAAAGTATGGGTACTGTTAT
TACCCGTCAATTGTACGATGGTCTCAGTTTGGTTCAGTTTAACTTGTAAG
ATCTCTTGATATATACAAGAGATTCTCTTTGTA
back to top