DY257726

Overview
NameDY257726
Unique NameDY257726
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1111
Libraries
Library NameType
AbsCOv1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Homology
BLAST of DY257726 vs. ExPASy Swiss-Prot
Match: EP1G_DAUCA (Epidermis-specific secreted glycoprotein EP1 OS=Daucus carota GN=EP1 PE=1 SV=1)

HSP 1 Score: 283.878 bits (725), Expect = 1.181e-75
Identity = 147/274 (53.65%), Postives = 186/274 (67.88%), Query Frame = 1
Query:    1 GNLVLAEANGTVVWQSNTSNKGVVGFKVLPNGNMVLHDSKGNFIWQSFDYPTDTLLVGQSLRVGGVTKLVSRLSIKENVDGPYSFVMESDRLSLYYKSSNVPRPVVYFTFPV-----QFSGLKNVTFNSAPETDEAFAYQLTL----DSSSGGGLILARPKYNATISFLRLGVDGNLRIFTYYDKVDSQPTEETFTLFDR------------DSIWETECQLPERCGKFGLCDDNQCVACPTEKG-LLGWSKECAPTLVNFCRIAAFHYYKVEG 756
            GNLVLA +NG V WQ++T+NKGVVG K+LPNGNMVL+DSKG F+WQSFD PTDTLLVGQSL++G VTKLVSR S  ENV+GPYS VME   L LYYK +  P+P+ Y++F +     +   L+NVTF    E D+ FA+ L+L     +S GG  IL R KYN T+SFLRL +DGN++I+TY DKVD    E T+TLF +                 +ECQLP++CG FGLC+++QCV CPT  G +L WSK C P  ++ C    FHY K+ G
Sbjct:  112 GNLVLARSNGQVAWQTSTANKGVVGLKILPNGNMVLYDSKGKFLWQSFDTPTDTLLVGQSLKMGAVTKLVSRASPGENVNGPYSLVMEPKGLHLYYKPTTSPKPIRYYSFSLFTKLNKNESLQNVTFEFENENDQGFAFLLSLKYGTSNSLGGASILNRIKYNTTLSFLRLEIDGNVKIYTYNDKVDYGAWEVTYTLFLKAPPPLFQVSLAATESESSECQLPKKCGNFGLCEESQCVGCPTSSGPVLAWSKTCEPPKLSSCGPKDFHYNKLGG 385          
BLAST of DY257726 vs. ExPASy Swiss-Prot
Match: SLSG2_BRAOA (S-locus-specific glycoprotein BS29-2 OS=Brassica oleracea var. alboglabra GN=SLSG PE=2 SV=1)

HSP 1 Score: 85.5001 bits (210), Expect = 6.162e-16
Identity = 85/308 (27.60%), Postives = 128/308 (41.56%), Query Frame = 1
Query:    4 NLVLAEANGTVVWQSNTSN---KGVVGFKVLPNGNMVLHDSKGN----FIWQSFDYPTDTLL----VGQSLRVGGVTKLVSRLSIKENVDGPYSFVMESDRLSLYYKSSNVPRPVVYFTFPVQFSGLKN-VTFNSAPETDEA--FAYQLTLDSSSGGGLILARPKYNATISFLRLGVDGNLRIFTYYDKVDSQPTEETFTLFDRDSIWETECQLPERCGKFGLCDDNQCVAC----------PTEKGLLGWSKECAPTLVNFCRIAAFHYYKVEGVDHYISKYNNGTGPIRVEDCGNRCSTDCRCVGY 855
            NLVL + +   +W +N +    +  V  ++L NGN VL DS  N    F+WQSFDYPTDTLL    +G  LR G    L S  S  +   G +S+ +++ RL  +Y   +         F V  SG  N V F+  PE  +     Y  T +S       L     N+  S L +   G      Y++++   P+   + +F   S  + +C + + CG +  CD N    C            E GL  WS  C       C    F   K   +        + +  I +++C  RC +DC C  +
Sbjct:  105 NLVLLDHSNKSLWSTNHTRGNERSPVVAELLANGNFVLRDSNKNDRSGFLWQSFDYPTDTLLPEMKLGYDLRTGLNRFLTSWRSSDDPSSGDFSYKLQTRRLPEFYLFKD--------DFLVHRSGPWNGVGFSGMPEDQKLSYMVYNFTQNSEEVAYTFLM--TNNSIYSRLTISSSG------YFERLTWTPSSGMWNVF-WSSPEDFQCDVYKICGAYSYCDVNTSPVCNCIQRFDPSNVQEWGLRAWSGGCRRRTRLSCSGDGFTRMKKMKLPETTMAIVDRS--IGLKECEKRCLSDCNCTAF 393          
BLAST of DY257726 vs. ExPASy Swiss-Prot
Match: KPRO_MAIZE (Putative receptor protein kinase ZmPK1 OS=Zea mays GN=PK1 PE=2 SV=2)

HSP 1 Score: 82.4185 bits (202), Expect = 5.217e-15
Identity = 76/314 (24.20%), Postives = 129/314 (41.08%), Query Frame = 1
Query:    1 GNLVLAEANGTVVWQSNTSN-KGVVGFKVLPNGNMVLHDSKGNFIWQSFDYPTDTLLVGQSLRVGGVTKLVSRLSIKENVDGPYSFVMESDRLSLYYKSSNVPR-PVVYFTFPVQ--FSGLKNVTFNSAPETDEAFAYQLTLDSSSGGGLILARPKYNATISFLRLGVDGNLRIFTYYDKVDSQPTEETFTLFDRDSIWETE-------CQLPERCGKFGLCDDNQCVACPTEKGLL-----GWSKECAPTLVNFC---RIAAFHYYKVEGVDHYISKYNNGTGPIRVEDCGNRCSTDCRCVGYFLHQETSKCW 885
            GN+VL + +G  VW+++ +N  GV   ++L  GN+V+ DS GN +WQSFD PTDT L  Q   +   T+LV     +     P +++     LS+     +VP+   +Y+  P Q  +   +N  +NS        +  L     + G  ++A          L L  DGNLR+               +++ D D  W          C +   CG  G+C  +    C    G        W++ C   +   C      +  + ++   D + S   +    + +  C + C +DC C G+   + T  C+
Sbjct:  109 GNMVLTDYDGAAVWRADGNNFTGVQRARLLDTGNLVIEDSGGNTVWQSFDSPTDTFLPTQ--LITAATRLVPTTQSR----SPGNYIFRFSDLSVLSLIYHVPQVSDIYWPDPDQNLYQDGRN-QYNSTRLGMLTDSGVLASSDFADGQALVASDVGPGVKRRLTLDPDGNLRL---------------YSMNDSDGSWSVSMVAMTQPCNIHGLCGPNGICHYSPTPTCSCPPGYATRNPGNWTEGCMAIVNTTCDRYDKRSMRFVRLPNTDFWGSDQQHLLS-VSLRTCRDICISDCTCKGFQYQEGTGSCY 399          
BLAST of DY257726 vs. ExPASy Swiss-Prot
Match: SRK6_BRAOE (Putative serine/threonine-protein kinase receptor OS=Brassica oleracea var. acephala GN=SRK6 PE=2 SV=1)

HSP 1 Score: 82.0333 bits (201), Expect = 6.813e-15
Identity = 81/308 (26.30%), Postives = 130/308 (42.21%), Query Frame = 1
Query:    4 NLVLAEANGTVVWQSNTSN---KGVVGFKVLPNGNMVLHDSKGN----FIWQSFDYPTDTLL----VGQSLRVGGVTKLVSRLSIKENVDGPYSFVMESDRLSLYYKSSNVPRPVVYFTFPVQFSGLKN-VTFNSAPETDEAFAYQL-TLDSSSGGGLILARPKYNATISFLRLGVDGNLRIFTYYDKVDSQPTEETFTLFDRDSIWETECQLPERCGKFGLCDDNQCVACPTEKGL----------LGWSKECAPTLVNFCRIAAF-HYYKVEGVDHYISKYNNGTGPIRVEDCGNRCSTDCRCVGY 855
            NLVL + +   VW +N +    +  V  ++L NGN V+ DS  N    ++WQSFDYPTDTLL    +G +L+ G    L S  S  +   G +S+ +E+  L  +Y S           FP+  SG  N + F+  PE D+  +Y +     ++       R   N+  S L L  +G  +  T+Y      P+   +  F    + + +C     CG +  CD N    C   +G             W+  C       C    F    K++  +  ++  +   G   V++C  RC +DC C  +
Sbjct:  105 NLVLLDHSNKPVWWTNLTRGNERSPVVAELLANGNFVMRDSSNNDASEYLWQSFDYPTDTLLPEMKLGYNLKTGLNRFLTSWRSSDDPSSGNFSYKLETQSLPEFYLSRE--------NFPMHRSGPWNGIRFSGIPE-DQKLSYMVYNFIENNEEVAYTFRMTNNSFYSRLTLISEGYFQRLTWY------PSIRIWNRFWSSPV-DPQCDTYIMCGPYAYCDVNTSPVCNCIQGFNPRNIQQWDQRVWAGGCIRRTQLSCSGDGFTRMKKMKLPETTMATVDRSIG---VKECKKRCISDCNCTAF 393          
BLAST of DY257726 vs. ExPASy Swiss-Prot
Match: SLSG3_BRAOL (S-locus-specific glycoprotein S13 OS=Brassica oleracea GN=SLSG PE=2 SV=2)

HSP 1 Score: 80.4925 bits (197), Expect = 1.982e-14
Identity = 81/311 (26.05%), Postives = 126/311 (40.51%), Query Frame = 1
Query:    4 NLVLAEANGTVVWQSNTSN---KGVVGFKVLPNGNMVLHDSKGN----FIWQSFDYPTDTLL----VGQSLRVGGVTKLVSRLSIKENVDGPYSFVMESDRLSLYYKSSNVPRPVVYFTFPVQFSGLKN-VTFNSAPETDEA--FAYQLTLDSSSGGGLILARPKYNATISFLRLGVDGNLRIFTYYDKVDSQPTEETFTLFDRDSIWET---ECQLPERCGKFGLCDDNQCVACPTEKGLLGWSKE----------CAPTLVNFCRIAAFHYYKVEGVDHYISKYNNGTGPIRVEDCGNRCSTDCRCVGY 855
            NLVL + +   VW +N +    +  V  ++L NGN V+ DS  N    F+WQSFDYPTDTLL    +G  L+ G    L S  S  +   G YS+ +E  RL  +Y SS         +F +  SG  N    +  PE  +     Y  T +S       L     N+  S L +   G      Y++++   P+   + +F     W +   +C +   CG +  CD N    C   +G    +++          C       C    F   K   +        + +  I +++C  RC +DC C  +
Sbjct:  106 NLVLLDHSNKSVWSTNVTRGNERSPVVAELLDNGNFVMRDSNSNNASQFLWQSFDYPTDTLLPEMKLGYDLKTGLNRFLTSWRSSDDPSSGDYSYKLELRRLPEFYLSSG--------SFRLHRSGPWNGFRISGIPEDQKLSYMVYNFTENSEEAAYTFLM--TNNSFYSRLTISSTG------YFERLTWAPSSVVWNVF-----WSSPNHQCDMYRMCGPYSYCDVNTSPVCNCIQGFRPKNRQQWDLRIPTSGCIRRTRLSCSGDGFTRMKNMKLPETTMAIVHRS--IGLKECEKRCLSDCNCTAF 393          
BLAST of DY257726 vs. ExPASy Swiss-Prot
Match: SLSG0_BRAOA (S-locus-specific glycoprotein OS=Brassica oleracea var. alboglabra GN=SLSG PE=2 SV=1)

HSP 1 Score: 78.5666 bits (192), Expect = 7.533e-14
Identity = 86/314 (27.39%), Postives = 144/314 (45.86%), Query Frame = 1
Query:    4 NLVLAEANGTVVWQSNTSNKG--VVGFKVLPNGNMVLHDSKGN----FIWQSFDYPTDTLL----VGQSLRVGGVTK--LVSRLSIKENVDGPYSFVMESDR-LSLYYKSSNVPRPVVYFTFP---VQFSG---LKNVTF--NSAPETDEAFAYQLTLDSSSGGGLILARPKYNATISFLRLGVDGNLRIFTYYDKVDSQPTEETFTLFDRDSIWETECQLPERCGKFGLCDDNQCVACPTEKGLL-----GWS-KECAPTLVNFCRIAAFH---YYKVEGVDHYISKYNNGTGPIRVEDCGNRCSTDCRCVGY 855
            +LVL + + T VW +N +      V  ++L NGN VL DSK N    F+WQSFDYP DTLL    +G++L +G   +  L S  S  +   G +SF++E++  L  +Y   N  +  VY T P   V+F+G   ++N ++  NS  + +E  AY   ++++           +N    F R+   G L++ T+   V   P    F  F  D+     C L + CG +  CD +    C   KG +      W  ++ +   V   +++      + ++  +    +        I +++C  +C  DC C GY
Sbjct:  110 SLVLLDHSNTPVWSTNFTGVAHLPVTAELLANGNFVLRDSKTNDLDRFMWQSFDYPVDTLLPEMKLGRNL-IGSENEKILTSWKSPTDPSSGDFSFILETEGFLHEFYLLKNEFK--VYRTGPWNGVRFNGIPKMQNWSYIDNSFIDNNEEVAYSFQVNNN-----------HNIHTRF-RMSSTGYLQVITWTKTV---PQRNMFWSFPEDT-----CDLYKVCGPYAYCDMHTSPTCNCIKGFVPKNAGRWDLRDMSGGCVRSSKLSCGEGDGFLRMSQMKLPETSEAVVDKRIGLKECREKCVRDCNCTGY 400          
BLAST of DY257726 vs. ExPASy Swiss-Prot
Match: SLSG1_BRAOA (S-locus-specific glycoprotein BS29-1 OS=Brassica oleracea var. alboglabra GN=SLSG PE=2 SV=1)

HSP 1 Score: 78.1814 bits (191), Expect = 9.838e-14
Identity = 85/313 (27.16%), Postives = 142/313 (45.37%), Query Frame = 1
Query:    4 NLVLAEANGTVVWQSNTSNKG--VVGFKVLPNGNMVLHDSK----GNFIWQSFDYPTDTLL----VGQSLRVGGVTK-LVSRLSIKENVDGPYSFVMESDR-LSLYYKSSNVPRPVVYFTFP---VQFSG---LKNVTF--NSAPETDEAFAYQLTLDSSSGGGLILARPKYNATISFLRLGVDGNLRIFTYYDKVDSQPTEETFTLFDRDSIWETECQLPERCGKFGLCDDNQCVACPTEKGLL-----GWS-KECAPTLVNFCRIAAFH---YYKVEGVDHYISKYNNGTGPIRVEDCGNRCSTDCRCVGY 855
            +LVL + + T VW +N +      V  ++L NGN VL DSK      F+WQSFDYP DTLL    +G++    G  K L S  S  +   G YSF++E++  L  +Y  +N  +  VY T P   V+F+G   ++N ++  NS  + ++  AY   ++++           +N    F R+   G L++ T+   V   P    F  F  D+     C L + CG +  CD +    C   KG +      W  ++ +   V   +++      + ++  +    +        I +++C  +C  DC C GY
Sbjct:  110 SLVLLDHSNTPVWSTNFTGVAHLPVTAELLANGNFVLRDSKTTALDRFMWQSFDYPVDTLLPEMKLGRNRNGSGNEKILTSWKSPTDPSSGDYSFILETEGFLHEFYLLNNEFK--VYRTGPWNGVRFNGIPKMQNWSYIDNSFIDNNKEVAYSFQVNNN-----------HNIHTRF-RMSSTGYLQVITWTKTV---PQRNMFWSFPEDT-----CDLYKVCGPYAYCDMHTSPTCNCIKGFVPKNAGRWDLRDMSGGCVRSSKLSCGEGDGFLRMSQMKLPETSEAVVDKRIGLKECREKCVRDCNCTGY 400          
BLAST of DY257726 vs. ExPASy Swiss-Prot
Match: SLSG6_BRAOL (S-locus-specific glycoprotein S6 OS=Brassica oleracea GN=SLSG PE=2 SV=2)

HSP 1 Score: 75.8702 bits (185), Expect = 4.883e-13
Identity = 80/307 (26.06%), Postives = 122/307 (39.74%), Query Frame = 1
Query:    4 NLVLAEANGTVVWQSNTSNKGV---VGFKVLPNGNMVLHDSKGN----FIWQSFDYPTDTLL----VGQSLRVGGVTKLVSRLSIKENVDGPYSFVMESDRLSLYYKSSNVPRPVVYFTFPVQFSGLKN-VTFNSAPETDEAFAYQL-TLDSSSGGGLILARPKYNATISFLRLGVDGNLRIFTYYDKVDSQPTEETFTLFDRDSIWETECQLPERCGKFGLCDDNQCVACPTEKGL----------LGWSKECAPTLVNFCRIAAFHYYKVEGVDHYISKYNNGTGPIRVEDCGNRCSTDCRCVGY 855
            NLVL       VW +N +       V  ++L NGN V+ DS  N    ++WQSFDYPTDTLL    +G  L+ G    L S  S  +   G +S+ +E+  L  +Y    +        FP+  SG  N V F+  PE D+  +Y +     +S       R   N+  S L L  +G      Y+ ++   P+   +  F    + + +C     CG +  C  N    C   +G             W+  C       C    F   K   +        + +  I V++C  RC +DC C  +
Sbjct:  106 NLVLLGHTNKSVWSTNLTRGNERLPVVAELLSNGNFVMRDSSNNDASEYLWQSFDYPTDTLLPEMKLGYDLKTGLNRFLTSWRSSDDPSSGDFSYKLETRSLPEFYLWHGI--------FPMHRSGPWNGVRFSGIPE-DQKLSYMVYNFTENSEEVAYTFRMTNNSIYSRLTLSSEG------YFQRLTWNPSIGIWNRFWSSPV-DPQCDTYIMCGPYAYCGVNTSPVCNCIQGFNPRNIQQWDQRVWAGGCIRRTRLSCSGDGFTRMKNMKLPETTMAIVDRS--IGVKECEKRCLSDCNCTAF 394          
The following BLAST results are available for this feature:
BLAST of DY257726 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 8
Match NameE-valueIdentityDescription
EP1G_DAUCA1.181e-7553.65Epidermis-specific secreted glycoprotein EP1 OS=Da... [more]
SLSG2_BRAOA6.162e-1627.60S-locus-specific glycoprotein BS29-2 OS=Brassica o... [more]
KPRO_MAIZE5.217e-1524.20Putative receptor protein kinase ZmPK1 OS=Zea mays... [more]
SRK6_BRAOE6.813e-1526.30Putative serine/threonine-protein kinase receptor ... [more]
SLSG3_BRAOL1.982e-1426.05S-locus-specific glycoprotein S13 OS=Brassica oler... [more]
SLSG0_BRAOA7.533e-1427.39S-locus-specific glycoprotein OS=Brassica oleracea... [more]
SLSG1_BRAOA9.838e-1427.16S-locus-specific glycoprotein BS29-1 OS=Brassica o... [more]
SLSG6_BRAOL4.883e-1326.06S-locus-specific glycoprotein S6 OS=Brassica olera... [more]
back to top
Properties
Property NameValue
Genbank descriptionKN0AAB1AD11ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257726 ID=DY257726|Name=DY257726|organism=Citrus clementina|type=EST|length=1111bp
GGGAATCTTGTCTTGGCGGAAGCAAATGGCACCGTCGTATGGCAATCCAA
CACTTCCAACAAAGGTGTTGTGGGGTTCAAGGTGCTCCCGAATGGAAACA
TGGTGCTTCATGACTCAAAGGGTAACTTTATCTGGCAGAGTTTTGATTAT
CCGACTGATACTCTCTTGGTGGGTCAGTCTCTTCGCGTCGGTGGGGTCAC
CAAGCTCGTGAGCAGACTTTCCATTAAAGAAAACGTTGACGGCCCTTACA
GCTTTGTAATGGAGTCTGATAGATTGTCACTCTATTACAAAAGCAGCAAT
GTTCCCCGGCCCGTTGTTTACTTTACTTTCCCTGTCCAGTTTAGTGGCTT
AAAGAATGTAACGTTCAATTCTGCCCCGGAAACTGATGAAGCTTTCGCTT
ATCAACTGACTCTAGATTCTTCATCCGGGGGCGGTCTTATTTTGGCAAGG
CCAAAGTACAACGCCACTATATCGTTTCTTCGGCTAGGAGTAGATGGGAA
TCTCAGGATCTTTACTTATTACGACAAGGTTGATTCGCAGCCAACGGAAG
AAACATTCACTCTCTTTGATAGAGATTCAATTTGGGAAACTGAGTGTCAG
CTTCCTGAGAGATGTGGTAAATTTGGACTGTGTGATGACAATCAATGTGT
TGCTTGTCCTACAGAGAAGGGCTTGCTTGGCTGGAGTAAAGAGTGTGCAC
CGACGCTAGTGAATTTTTGTCGGATAGCGGCTTTCCATTATTATAAAGTT
GAAGGGGTTGATCATTATATTAGCAAATATAATAATGGAACTGGACCCAT
CAGAGTTGAAGATTGTGGCAACAGATGTAGCACGGATTGTAGATGTGTGG
GGTATTTTTTACATCAGGAGACATCGAAATGTTGGATTGCTTTTGACTTG
AAGACTCTTACCAAATCCCCCAACTCTACACATGGTGGAATCCTCCAGGT
TTGCCCCGCAATAAATTATCAAATAAGTGGAATAAAATTTGTGAATCGAA
ATAACAACAGAAAGAATATGGGGGCTTTCAATGCCCCCCCAAAAAAAAAA
CTGTTGTTTTGTCCATATTTAAAAATAATGAAATGAATGGAATGAAAATG
TTTTGGGTTNN
back to top