DY257729

Overview
NameDY257729
Unique NameDY257729
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length313
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB1AE06ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257729 ID=DY257729|Name=DY257729|organism=Citrus clementina|type=EST|length=313bp
ATAATCGAACAAGCTCTTTGGAAGATCGCTGGTAAGTGTTAAGAAGTAAG
ATCTCAAACTAGTAATCAATTTGCAGTTGTAGTCTTCTTCAATTGTGTAG
GTTTAGTTCCTTAGTGTTTTGAATGCATAGTTGTAATGAGAGAAAATCCT
TCAGTGTAACTTATCTAGGATTTGCTATGTTGTATCCCACTTGAATAAAG
CAATTTAATTTGACAATCCTTACTAGGTAGCGGGAAGATGACTACAATCG
CACAAACCATGTGATGATTCGATATCTTAAAGTAATCTATGTGGCTTCAT
AAACAAAAAAAAA
back to top