DY257730

Overview
NameDY257730
Unique NameDY257730
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1500
Libraries
Library NameType
AbsCOv1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10339 contig Ccv1_Contig10339:613..2109. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of DY257730 vs. ExPASy Swiss-Prot
Match: ENO_RICCO (Enolase OS=Ricinus communis PE=2 SV=1)

HSP 1 Score: 387.497 bits (994), Expect = 1.657e-114
Identity = 193/217 (88.94%), Postives = 207/217 (95.39%), Query Frame = 1
Query:   76 IKIIQGQDATNVGEERGFAPNIQDNMEGLELLNTAIAKTGYTGKVVIGMDVAASEFYGSNKTYDLNFKEDNNDGSQKISRDALKDLYKSFISDYPIVSIENPFDQDNWEHYAKLTSEVGEKVQIVGDDLLVTNPKRVEKAIKEKTCNALLLKVNQIGSVTESIEAVRMSKQAGWGVMASHRSGETENTFIADLSVGLATGQIKTGAPCRSKRLAKYN 726
            IK   GQDATNVG+E GFAPNIQ+N EGLELL TAIAK GYTGKVVIGMDVAASEFYGS+KTYDLNFKE+NNDGSQKIS +ALKDLYKSF S+YPIVSIE+PFDQD+WEHY+KLTSE+GEKVQIVGDDLLVTNPKRVEKAI+EK CNALLLKVNQIGSVTESIEAVRMSK+AGWGVMASHRSGETE+TFIADLSVGLATGQIKTGAPCRS+RLAKYN
Sbjct:  202 IKKKYGQDATNVGDEGGFAPNIQENKEGLELLKTAIAKAGYTGKVVIGMDVAASEFYGSDKTYDLNFKEENNDGSQKISGEALKDLYKSFASEYPIVSIEDPFDQDDWEHYSKLTSEIGEKVQIVGDDLLVTNPKRVEKAIQEKACNALLLKVNQIGSVTESIEAVRMSKRAGWGVMASHRSGETEDTFIADLSVGLATGQIKTGAPCRSERLAKYN 418          

HSP 2 Score: 45.4394 bits (106), Expect = 1.657e-114
Identity = 22/27 (81.48%), Postives = 23/27 (85.19%), Query Frame = 2
Query:  728 QLLRIEEELGAKPF*AGAKFRAPVEPY 808
            QLLRIEEELGA+   AGAKFR PVEPY
Sbjct:  419 QLLRIEEELGAEAVYAGAKFRTPVEPY 445          
BLAST of DY257730 vs. ExPASy Swiss-Prot
Match: ENO2_HEVBR (Enolase 2 OS=Hevea brasiliensis GN=ENO2 PE=1 SV=1)

HSP 1 Score: 384.8 bits (987), Expect = 4.035e-113
Identity = 191/217 (88.02%), Postives = 206/217 (94.93%), Query Frame = 1
Query:   76 IKIIQGQDATNVGEERGFAPNIQDNMEGLELLNTAIAKTGYTGKVVIGMDVAASEFYGSNKTYDLNFKEDNNDGSQKISRDALKDLYKSFISDYPIVSIENPFDQDNWEHYAKLTSEVGEKVQIVGDDLLVTNPKRVEKAIKEKTCNALLLKVNQIGSVTESIEAVRMSKQAGWGVMASHRSGETENTFIADLSVGLATGQIKTGAPCRSKRLAKYN 726
            IK   GQDATNVG+E GFAPNIQ+N EGLELL TAIAK GYTGKVVIGMDVAASEFYGS+KTYDLNFKE+NN+GSQKIS D LKDLYKSF+++YPIVSIE+PFDQD+WEHYAKLTSE+G KVQIVGDDLLVTNPKRVEKAIKEK CNALLLKVNQIGSVTESIEAV+MSK+AGWGVMASHRSGETE+TFIADLSVGLATGQIKTGAPCRS+RLAKYN
Sbjct:  202 IKKKYGQDATNVGDEGGFAPNIQENKEGLELLKTAIAKAGYTGKVVIGMDVAASEFYGSDKTYDLNFKEENNNGSQKISGDVLKDLYKSFVTEYPIVSIEDPFDQDDWEHYAKLTSEIGVKVQIVGDDLLVTNPKRVEKAIKEKACNALLLKVNQIGSVTESIEAVKMSKRAGWGVMASHRSGETEDTFIADLSVGLATGQIKTGAPCRSERLAKYN 418          

HSP 2 Score: 43.5134 bits (101), Expect = 4.035e-113
Identity = 21/27 (77.78%), Postives = 22/27 (81.48%), Query Frame = 2
Query:  728 QLLRIEEELGAKPF*AGAKFRAPVEPY 808
            QLLRIEEELGA+   AGA FR PVEPY
Sbjct:  419 QLLRIEEELGAEAVYAGANFRTPVEPY 445          
BLAST of DY257730 vs. ExPASy Swiss-Prot
Match: ENO1_HEVBR (Enolase 1 OS=Hevea brasiliensis GN=ENO1 PE=1 SV=1)

HSP 1 Score: 383.645 bits (984), Expect = 2.598e-112
Identity = 190/217 (87.56%), Postives = 207/217 (95.39%), Query Frame = 1
Query:   76 IKIIQGQDATNVGEERGFAPNIQDNMEGLELLNTAIAKTGYTGKVVIGMDVAASEFYGSNKTYDLNFKEDNNDGSQKISRDALKDLYKSFISDYPIVSIENPFDQDNWEHYAKLTSEVGEKVQIVGDDLLVTNPKRVEKAIKEKTCNALLLKVNQIGSVTESIEAVRMSKQAGWGVMASHRSGETENTFIADLSVGLATGQIKTGAPCRSKRLAKYN 726
            IK   GQDATNVG+E GFAPNIQ+N EGLELL TAIAK GYTGKVVIGMDVAASEFYGS++TYDLNFKE+NN+GSQKIS +ALKDLYKSF+++YPIVSIE+PFDQD+W HYAKLTSE+GEKVQIVGDDLLVTNPKRVEKAIKEK CNALLLKVNQIGSVTESIEAV+MSK+AGWGVMASHRSGETE+TFIADLSVGLATGQIKTGAPCRS+RLAKYN
Sbjct:  202 IKKKYGQDATNVGDEGGFAPNIQENKEGLELLKTAIAKAGYTGKVVIGMDVAASEFYGSDQTYDLNFKEENNNGSQKISGEALKDLYKSFVAEYPIVSIEDPFDQDDWAHYAKLTSEIGEKVQIVGDDLLVTNPKRVEKAIKEKACNALLLKVNQIGSVTESIEAVKMSKRAGWGVMASHRSGETEDTFIADLSVGLATGQIKTGAPCRSERLAKYN 418          

HSP 2 Score: 41.9726 bits (97), Expect = 2.598e-112
Identity = 20/27 (74.07%), Postives = 22/27 (81.48%), Query Frame = 2
Query:  728 QLLRIEEELGAKPF*AGAKFRAPVEPY 808
            QLLRIEEELG++   AGA FR PVEPY
Sbjct:  419 QLLRIEEELGSEAVYAGANFRKPVEPY 445          
BLAST of DY257730 vs. ExPASy Swiss-Prot
Match: ENO_MESCR (Enolase OS=Mesembryanthemum crystallinum GN=PGH1 PE=2 SV=1)

HSP 1 Score: 370.163 bits (949), Expect = 2.202e-108
Identity = 183/226 (80.97%), Postives = 205/226 (90.71%), Query Frame = 1
Query:   49 EITAGRRGEIKIIQGQDATNVGEERGFAPNIQDNMEGLELLNTAIAKTGYTGKVVIGMDVAASEFYGSNKTYDLNFKEDNNDGSQKISRDALKDLYKSFISDYPIVSIENPFDQDNWEHYAKLTSEVGEKVQIVGDDLLVTNPKRVEKAIKEKTCNALLLKVNQIGSVTESIEAVRMSKQAGWGVMASHRSGETENTFIADLSVGLATGQIKTGAPCRSKRLAKYN 726
            E+    +  IK   GQDATNVG+E GFAPNIQ+N EGLELL TAI K GYTGKVVIGMDVAASEFY  +K+YDLNFKE+NNDGSQ+IS +ALKDLYKSF+++YPIVSIE+PFDQD+WEHYAK+T+E GEKVQIVGDDLLVTNPKRV+KAI E  CNALLLKVNQIGSVTESIEAV+MSK+AGWGVMASHRSGETE+TFIADLSVGL+TGQIKTGAPCRS+RLAKYN
Sbjct:  192 EVYHNLKSVIKKKYGQDATNVGDEGGFAPNIQENKEGLELLKTAIEKAGYTGKVVIGMDVAASEFYKEDKSYDLNFKEENNDGSQRISGEALKDLYKSFVAEYPIVSIEDPFDQDDWEHYAKMTAECGEKVQIVGDDLLVTNPKRVKKAIDENPCNALLLKVNQIGSVTESIEAVKMSKKAGWGVMASHRSGETEDTFIADLSVGLSTGQIKTGAPCRSERLAKYN 417          

HSP 2 Score: 42.3578 bits (98), Expect = 2.202e-108
Identity = 21/27 (77.78%), Postives = 21/27 (77.78%), Query Frame = 2
Query:  728 QLLRIEEELGAKPF*AGAKFRAPVEPY 808
            QLLRIEEELG K   AGA FR PVEPY
Sbjct:  418 QLLRIEEELGDKAVYAGANFRRPVEPY 444          
BLAST of DY257730 vs. ExPASy Swiss-Prot
Match: ENO_ORYSJ (Enolase OS=Oryza sativa subsp. japonica GN=ENO1 PE=1 SV=2)

HSP 1 Score: 366.311 bits (939), Expect = 2.202e-108
Identity = 182/227 (80.18%), Postives = 206/227 (90.75%), Query Frame = 1
Query:   49 EITAGRRGEIKIIQGQDATNVGEERGFAPNIQDNMEGLELLNTAIAKTGYTGKVVIGMDVAASEFYGS-NKTYDLNFKEDNNDGSQKISRDALKDLYKSFISDYPIVSIENPFDQDNWEHYAKLTSEVGEKVQIVGDDLLVTNPKRVEKAIKEKTCNALLLKVNQIGSVTESIEAVRMSKQAGWGVMASHRSGETENTFIADLSVGLATGQIKTGAPCRSKRLAKYN 726
            E+    +  IK   GQDATNVG+E GFAPNIQ+N EGLELL TAI K GYTGKVVIGMDVAASEFY   +KTYDLNFKE+NNDGSQKIS D+LK++YKSF+S+YPIVSIE+PFDQD+WEHYAK+T+E+GE+VQIVGDDLLVTNP RV KAI+EK+CNALLLKVNQIGSVTESIEAV+MSK+AGWGVM SHRSGETE+TFIADL+VGLATGQIKTGAPCRS+RLAKYN
Sbjct:  193 EVYHNLKSVIKKKYGQDATNVGDEGGFAPNIQENKEGLELLKTAIEKAGYTGKVVIGMDVAASEFYNDKDKTYDLNFKEENNDGSQKISGDSLKNVYKSFVSEYPIVSIEDPFDQDDWEHYAKMTAEIGEQVQIVGDDLLVTNPTRVAKAIQEKSCNALLLKVNQIGSVTESIEAVKMSKRAGWGVMTSHRSGETEDTFIADLAVGLATGQIKTGAPCRSERLAKYN 419          

HSP 2 Score: 46.2098 bits (108), Expect = 2.202e-108
Identity = 23/27 (85.19%), Postives = 23/27 (85.19%), Query Frame = 2
Query:  728 QLLRIEEELGAKPF*AGAKFRAPVEPY 808
            QLLRIEEELGA    AGAKFRAPVEPY
Sbjct:  420 QLLRIEEELGAAAVYAGAKFRAPVEPY 446          
BLAST of DY257730 vs. ExPASy Swiss-Prot
Match: ENO_SOLLC (Enolase OS=Solanum lycopersicum GN=PGH1 PE=2 SV=1)

HSP 1 Score: 370.163 bits (949), Expect = 2.872e-108
Identity = 183/217 (84.33%), Postives = 202/217 (93.09%), Query Frame = 1
Query:   76 IKIIQGQDATNVGEERGFAPNIQDNMEGLELLNTAIAKTGYTGKVVIGMDVAASEFYGSNKTYDLNFKEDNNDGSQKISRDALKDLYKSFISDYPIVSIENPFDQDNWEHYAKLTSEVGEKVQIVGDDLLVTNPKRVEKAIKEKTCNALLLKVNQIGSVTESIEAVRMSKQAGWGVMASHRSGETENTFIADLSVGLATGQIKTGAPCRSKRLAKYN 726
            IK   GQDATNVG+E GFAPNIQ+N EGLELL TAI K GYTGKVVIGMDVAASEFYG +K+YDLNFKE++NDGSQKIS D LKDLYKSF+S+YPIVSIE+PFDQD+WE YAKLT+E+GE+VQIVGDDLLVTNPKRV KAI EKTCNALLLKVNQIGSVTESIEAV+MSK+AGWGVM SHRSGETE+TFIADL+VGL+TGQIKTGAPCRS+RLAKYN
Sbjct:  201 IKKKYGQDATNVGDEGGFAPNIQENKEGLELLKTAIEKAGYTGKVVIGMDVAASEFYGKDKSYDLNFKEESNDGSQKISGDQLKDLYKSFVSEYPIVSIEDPFDQDDWETYAKLTAEIGEQVQIVGDDLLVTNPKRVAKAIAEKTCNALLLKVNQIGSVTESIEAVKMSKKAGWGVMTSHRSGETEDTFIADLAVGLSTGQIKTGAPCRSERLAKYN 417          

HSP 2 Score: 41.9726 bits (97), Expect = 2.872e-108
Identity = 20/27 (74.07%), Postives = 22/27 (81.48%), Query Frame = 2
Query:  728 QLLRIEEELGAKPF*AGAKFRAPVEPY 808
            QLLRIEEELG++   AGA FR PVEPY
Sbjct:  418 QLLRIEEELGSEAVYAGASFRKPVEPY 444          
BLAST of DY257730 vs. ExPASy Swiss-Prot
Match: ENO_ARATH (Enolase OS=Arabidopsis thaliana GN=ENO PE=1 SV=1)

HSP 1 Score: 367.851 bits (943), Expect = 3.147e-107
Identity = 181/217 (83.41%), Postives = 201/217 (92.63%), Query Frame = 1
Query:   76 IKIIQGQDATNVGEERGFAPNIQDNMEGLELLNTAIAKTGYTGKVVIGMDVAASEFYGSNKTYDLNFKEDNNDGSQKISRDALKDLYKSFISDYPIVSIENPFDQDNWEHYAKLTSEVGEKVQIVGDDLLVTNPKRVEKAIKEKTCNALLLKVNQIGSVTESIEAVRMSKQAGWGVMASHRSGETENTFIADLSVGLATGQIKTGAPCRSKRLAKYN 726
            IK   GQDATNVG+E GFAPNIQ+N EGLELL TAI K GYTGKVVIGMDVAASEFY  +KTYDLNFKE+NN+GSQKIS DALKDLYKSF+++YPIVSIE+PFDQD+WEHYAK+T+E G +VQIVGDDLLVTNPKRV KAI EK+CNALLLKVNQIGSVTESIEAV+MSK+AGWGVM SHRSGETE+TFIADL+VGL+TGQIKTGAPCRS+RLAKYN
Sbjct:  201 IKKKYGQDATNVGDEGGFAPNIQENKEGLELLKTAIEKAGYTGKVVIGMDVAASEFYSEDKTYDLNFKEENNNGSQKISGDALKDLYKSFVAEYPIVSIEDPFDQDDWEHYAKMTTECGTEVQIVGDDLLVTNPKRVAKAIAEKSCNALLLKVNQIGSVTESIEAVKMSKKAGWGVMTSHRSGETEDTFIADLAVGLSTGQIKTGAPCRSERLAKYN 417          

HSP 2 Score: 40.817 bits (94), Expect = 3.147e-107
Identity = 19/27 (70.37%), Postives = 21/27 (77.78%), Query Frame = 2
Query:  728 QLLRIEEELGAKPF*AGAKFRAPVEPY 808
            QLLRIEEELG++   AG  FR PVEPY
Sbjct:  418 QLLRIEEELGSEAIYAGVNFRKPVEPY 444          
BLAST of DY257730 vs. ExPASy Swiss-Prot
Match: ENO2_MAIZE (Enolase 2 OS=Zea mays GN=ENO2 PE=2 SV=1)

HSP 1 Score: 361.303 bits (926), Expect = 1.190e-106
Identity = 179/218 (82.11%), Postives = 201/218 (92.20%), Query Frame = 1
Query:   76 IKIIQGQDATNVGEERGFAPNIQDNMEGLELLNTAIAKTGYTGKVVIGMDVAASEFYGS-NKTYDLNFKEDNNDGSQKISRDALKDLYKSFISDYPIVSIENPFDQDNWEHYAKLTSEVGEKVQIVGDDLLVTNPKRVEKAIKEKTCNALLLKVNQIGSVTESIEAVRMSKQAGWGVMASHRSGETENTFIADLSVGLATGQIKTGAPCRSKRLAKYN 726
            IK   GQDATNVG+E GFAPNIQ+N EGLELL TAI K GYTGKVVIGMDVAASEFY   ++TYDLNFKE+NNDGSQKIS D+LK++YKSF+S+YPIVSIE+PFDQD+W HYAK+T E+GE+VQIVGDDLLVTNP RV KAIKEK+CNALLLKVNQIGSVTESIEAV+MSK+AGWGVM SHRSGETE+TFIADL+VGL+TGQIKTGAPCRS+RLAKYN
Sbjct:  202 IKKKYGQDATNVGDEGGFAPNIQENKEGLELLKTAIEKAGYTGKVVIGMDVAASEFYSDKDQTYDLNFKEENNDGSQKISGDSLKNVYKSFVSEYPIVSIEDPFDQDDWVHYAKMTEEIGEQVQIVGDDLLVTNPTRVAKAIKEKSCNALLLKVNQIGSVTESIEAVKMSKRAGWGVMTSHRSGETEDTFIADLAVGLSTGQIKTGAPCRSERLAKYN 419          

HSP 2 Score: 45.4394 bits (106), Expect = 1.190e-106
Identity = 23/27 (85.19%), Postives = 23/27 (85.19%), Query Frame = 2
Query:  728 QLLRIEEELGAKPF*AGAKFRAPVEPY 808
            QLLRIEEELGA    AGAKFRAPVEPY
Sbjct:  420 QLLRIEEELGAIAVYAGAKFRAPVEPY 446          
BLAST of DY257730 vs. ExPASy Swiss-Prot
Match: ENO1_MAIZE (Enolase 1 OS=Zea mays GN=ENO1 PE=2 SV=1)

HSP 1 Score: 362.459 bits (929), Expect = 1.553e-106
Identity = 183/227 (80.62%), Postives = 201/227 (88.55%), Query Frame = 1
Query:   49 EITAGRRGEIKIIQGQDATNVGEERGFAPNIQDNMEGLELLNTAIAKTGYTGKVVIGMDVAASEFYGS-NKTYDLNFKEDNNDGSQKISRDALKDLYKSFISDYPIVSIENPFDQDNWEHYAKLTSEVGEKVQIVGDDLLVTNPKRVEKAIKEKTCNALLLKVNQIGSVTESIEAVRMSKQAGWGVMASHRSGETENTFIADLSVGLATGQIKTGAPCRSKRLAKYN 726
            E+    +  IK   GQDATNVG+E GFAPNIQ+N EGLELL  AI K GYTGKVVIGMDVAASEF+G  +KTYDLNFKE+NNDGS KIS D+LKDLYKSF+S+YPI SIE+PFDQD+W  YAKLT E+G+KVQIVGDDLLVTNP RV KAI EKTCNALLLKVNQIGSVTESIEAVRMSK+AGWGVMASHRSGETE+TFIADLSVGL+TGQIKTGAPCRS+RLAKYN
Sbjct:  193 EVYHNLKSIIKKKYGQDATNVGDEGGFAPNIQENKEGLELLKAAIEKAGYTGKVVIGMDVAASEFFGEKDKTYDLNFKEENNDGSNKISGDSLKDLYKSFVSEYPIESIEDPFDQDDWSTYAKLTDEIGQKVQIVGDDLLVTNPTRVAKAINEKTCNALLLKVNQIGSVTESIEAVRMSKRAGWGVMASHRSGETEDTFIADLSVGLSTGQIKTGAPCRSERLAKYN 419          

HSP 2 Score: 43.8986 bits (102), Expect = 1.553e-106
Identity = 22/27 (81.48%), Postives = 22/27 (81.48%), Query Frame = 2
Query:  728 QLLRIEEELGAKPF*AGAKFRAPVEPY 808
            QLLRIEEELG     AGAKFRAPVEPY
Sbjct:  420 QLLRIEEELGDAAVYAGAKFRAPVEPY 446          
BLAST of DY257730 vs. ExPASy Swiss-Prot
Match: ENO_ALNGL (Enolase OS=Alnus glutinosa GN=PGH1 PE=2 SV=1)

HSP 1 Score: 350.132 bits (897), Expect = 2.236e-102
Identity = 181/217 (83.41%), Postives = 196/217 (90.32%), Query Frame = 1
Query:   76 IKIIQGQDATNVGEERGFAPNIQDNMEGLELLNTAIAKTGYTGKVVIGMDVAASEFYGSNKTYDLNFKEDNNDGSQKISRDALKDLYKSFISDYPIVSIENPFDQDNWEHYAKLTSEVGEKVQIVGDDLLVTNPKRVEKAIKEKTCNALLLKVNQIGSVTESIEAVRMSKQAGWGVMASHRSGETENTFIADLSVGLATGQIKTGAPCRSKRLAKYN 726
            IK   GQDATNVG+E GFAPNIQ+N EGLELL TAIAK GY   VVIGMDVAASEFY  +K    NFKE+NNDGSQKIS D LKDLYKSF+ +YPIVSIE+PFDQD+WEHY+KLT+E+GEKVQIVGDDLLVTNPKRVEKAIKEK CNALLLKVNQIGSVTESIEAV+MSK+AGWGVMA HRSGETE+TFIADLSVGLATGQIKTGAPCRS+RLAKYN
Sbjct:  202 IKKKYGQDATNVGDEGGFAPNIQENKEGLELLKTAIAKAGY---VVIGMDVAASEFYEKDKDIT-NFKEENNDGSQKISADQLKDLYKSFVDEYPIVSIEDPFDQDDWEHYSKLTAEIGEKVQIVGDDLLVTNPKRVEKAIKEKACNALLLKVNQIGSVTESIEAVKMSKRAGWGVMA-HRSGETEDTFIADLSVGLATGQIKTGAPCRSERLAKYN 413          

HSP 2 Score: 42.3578 bits (98), Expect = 2.236e-102
Identity = 20/27 (74.07%), Postives = 22/27 (81.48%), Query Frame = 2
Query:  728 QLLRIEEELGAKPF*AGAKFRAPVEPY 808
            QLLRIEEELG++   AGA FR PVEPY
Sbjct:  414 QLLRIEEELGSEAVYAGANFRTPVEPY 440          
The following BLAST results are available for this feature:
BLAST of DY257730 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 500
Match NameE-valueIdentityDescription
ENO_RICCO1.657e-11488.94Enolase OS=Ricinus communis PE=2 SV=1[more]
ENO2_HEVBR4.035e-11388.02Enolase 2 OS=Hevea brasiliensis GN=ENO2 PE=1 SV=1[more]
ENO1_HEVBR2.598e-11287.56Enolase 1 OS=Hevea brasiliensis GN=ENO1 PE=1 SV=1[more]
ENO_MESCR2.202e-10880.97Enolase OS=Mesembryanthemum crystallinum GN=PGH1 P... [more]
ENO_ORYSJ2.202e-10880.18Enolase OS=Oryza sativa subsp. japonica GN=ENO1 PE... [more]
ENO_SOLLC2.872e-10884.33Enolase OS=Solanum lycopersicum GN=PGH1 PE=2 SV=1[more]
ENO_ARATH3.147e-10783.41Enolase OS=Arabidopsis thaliana GN=ENO PE=1 SV=1[more]
ENO2_MAIZE1.190e-10682.11Enolase 2 OS=Zea mays GN=ENO2 PE=2 SV=1[more]
ENO1_MAIZE1.553e-10680.62Enolase 1 OS=Zea mays GN=ENO1 PE=2 SV=1[more]
ENO_ALNGL2.236e-10283.41Enolase OS=Alnus glutinosa GN=PGH1 PE=2 SV=1[more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionKN0AAB1AF02ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257730 ID=DY257730|Name=DY257730|organism=Citrus clementina|type=EST|length=1500bp
AAGAGAATTTACTTCAATATCACAAACGCGTATTTACTCGGGAAATAGGA
AATTACGGCCGGGAGGAGGGGGGAGATTAAGATAATACAGGGCCAGGATG
CTACTAATGTTGGTGAGGAACGCGGTTTTGCTCCCAATATTCAGGACAAC
ATGGAAGGACTTGAATTGCTCAACACAGCCATTGCTAAAACCGGTTACAC
AGGCAAAGTTGTCATTGGAATGGATGTTGCTGCATCTGAATTCTATGGCT
CAAATAAAACTTATGATCTGAACTTCAAGGAAGACAACAATGATGGTTCA
CAAAAGATCTCAAGAGATGCACTCAAAGATCTCTATAAGTCATTCATCTC
TGATTATCCTATTGTATCAATTGAAAATCCATTTGACCAAGACAACTGGG
AGCACTATGCCAAGCTAACCAGTGAGGTTGGAGAAAAAGTACAAATTGTT
GGAGATGATCTTTTGGTCACCAATCCTAAGAGGGTTGAGAAGGCTATCAA
AGAGAAGACCTGCAACGCCCTCCTTCTCAAGGTTAATCAAATTGGATCTG
TAACTGAGAGCATTGAAGCCGTCAGAATGTCCAAGCAAGCTGGGTGGGGT
GTGATGGCCAGCCACCGCAGTGGTGAGACTGAAAATACTTTCATTGCCGA
TCTCTCAGTGGGCTTGGCCACGGGTCAAATTAAGACAGGAGCACCATGCA
GGTCAAAGCGTCTTGCAAAGTATAATCCAGCTTCTGAGAATTGAAGAAGA
GCTCGGTGCTAAACCATTTTAAGCTGGTGCCAAATTCCGTGCCCCTGTTG
AACCCTACTAAATTTTGAGATGCTGAATCTGGTGTGGTGCTGGATTTAAC
CAATGGAAGTTTACCTTCAAAAAGTTATGTTAAATGGGTTTTTAAGGGGT
TTTTAGCATTTTGTGACCCCAAAAATTTCCCTCAAAAATTTGAAAACGTA
TGTTGTCTGAAAACTTGAACCTTGCTTGAATGAGGACCATTTCCCAAAAC
CAGTTTTATTAAAAGGAAATACTATATGCGGTGCCAAGGCGTTGTTTCTT
TCTTAATAAAACCCCAAAAAAAAATAAAAAAAAAAAAAAAAAAAAAATGC
TCGCCGCCCTCGCCCAAACAACCAAAAACTAAGAAAAACTATTCAGAGGG
GCCCAAATCACCCCTCATGGGCCAATCTCCCTAAAAGGAGCAAATAAAAT
ACCCCGGGCGTTTTTTTAACACTCCGGAACAGAAAAACCTGGCTCTCCCC
AATTATTTCCCTTTGTGAAAATCCCCCTTCTCCCCCCTGGGGAAAAAAAA
AAAAATCCCCCCACCACAACCCCCTCCCCAATATTCCCCCCCCCCCGAAG
CGAAGGAGAAATAATAAGATTATCTATTTTGTATTAATATCCCCTCATAT
TTTTTTTATTTATCCCCTTTTATATCCATCAACGTCCAAATAAATAAAAC
CCCCTCCATTATAACAAAAAACAGAATATCAAACAAGATGGTGAGGATGG
back to top