DY257731

Overview
NameDY257731
Unique NameDY257731
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length379
Libraries
Library NameType
AbsCOv1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9591 contig Ccv1_Contig9591:6..384. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAB1AF05ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257731 ID=DY257731|Name=DY257731|organism=Citrus clementina|type=EST|length=379bp
GGCTCAAGCACAACTACTTACCTTTTGAGTTTTGAATACGGTTCAGTCGA
AGCCAGCAGAAATCGTTTGCCTTCCTGATTTGAAGATTATGGGAACTCCT
TGCGCAGGTTATACCGATTGGTCGGAGGGGCTTATAGCCACAACTTTTTC
ACTTATTGCTGATGATGAAATTAATGGAAATATTGATCTTCTTGTGGTCC
CGCAATATGGAAGAAACCCTAATCACACTGGTTAAGAATATGCAGTATTA
GTCTCTTATGTTATGTTTAAGAAAATAAAAGTATGGGTACTGTTATTACC
CGTCAATTGTATGATGGTCTCAATTTGGTTCAATTTAACTTGTAAGATCT
CTTGATATATATAAGAGATTCTCTTTGTA
back to top