BQ623121

Overview
NameBQ623121
Unique NameBQ623121
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length542
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1283 contig Csv1_Contig1283:141..679. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HSP11_MEDSA (18.1 kDa class I heat shock protein (Fragment) OS=Medicago sativa GN=HSP18.1 PE=2 SV=1)

HSP 1 Score: 152.14 bits (383), Expect = 1.540e-36
Identity = 80/122 (65.57%), Postives = 88/122 (72.13%), Query Frame = 3
Query:  102 DPFSSDVWAP----------LGSSS--NEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            DPFS DVW P          L +SS   E S F S ++DWKET EAHVFKADLPGL          D RVLQISGER+VEKEDKND+WHRVER  GKF+RRFRLPENAK+DQVKA+MENGVL
Sbjct:    1 DPFSLDVWDPFKDFPFTNSALSASSFPQENSAFVSTRIDWKETPEAHVFKADLPGLKKEEVKVEIEDDRVLQISGERNVEKEDKNDQWHRVERSSGKFMRRFRLPENAKMDQVKAAMENGVL 122          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HSP11_HELAN (17.6 kDa class I heat shock protein OS=Helianthus annuus GN=HSP17.6 PE=2 SV=1)

HSP 1 Score: 150.599 bits (379), Expect = 4.481e-36
Identity = 75/131 (57.25%), Postives = 92/131 (70.23%), Query Frame = 3
Query:   60 MSLIPSIFGNR--SVFDPFSSDVWAPLGS-----SSNEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            MS+IPS F ++  ++FDPFS D W P         + E +   +A++DWKET EAHV KADLPG+          DGRVLQISGER  E+E+K+D WHRVER  GKF+RRFRLPENAK+D+VKA MENGVL
Sbjct:    1 MSIIPSFFTSKRSNIFDPFSLDTWDPFQGIISTEPARETAAIVNARIDWKETPEAHVLKADLPGMKKEEVKVEVEDGRVLQISGERCREQEEKDDTWHRVERSSGKFIRRFRLPENAKMDEVKAMMENGVL 131          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HS16C_ORYSJ (16.9 kDa class I heat shock protein 3 OS=Oryza sativa subsp. japonica GN=HSP16.9C PE=2 SV=1)

HSP 1 Score: 147.517 bits (371), Expect = 3.793e-35
Identity = 75/128 (58.59%), Postives = 90/128 (70.31%), Query Frame = 3
Query:   75 SIFGNRSVFDPFSSDVWAPL---------GSSSNEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            S+    +VFDPF+ D W P           +S  + + FA+A+VDWKET E+HVFKADLPG+          +G VL ISG+RS EKEDKNDKWHRVER  G+F+RRFRLPENAK+DQVKASMENGVL
Sbjct:    2 SLVRRSNVFDPFA-DFWDPFDGVFRSLVPATSDRDTAAFANARVDWKETPESHVFKADLPGVKKEEVKVEVEEGNVLVISGQRSKEKEDKNDKWHRVERSSGQFMRRFRLPENAKVDQVKASMENGVL 128          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HS181_ORYSJ (18.1 kDa class I heat shock protein OS=Oryza sativa subsp. japonica GN=HSP18.1 PE=2 SV=1)

HSP 1 Score: 146.747 bits (369), Expect = 6.471e-35
Identity = 75/139 (53.96%), Postives = 89/139 (64.03%), Query Frame = 3
Query:   75 SIFGNRSVFDPFSSDVWAPLGS--------------------SSNEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            S+    +VFDPFS D+W P                       +S+E + FA A++DWKET EAHVFKAD+PGL          DG VLQISGERS E+E+K DKWHRVER  GKF+RRFRLPEN K +Q+KASMENGVL
Sbjct:    2 SLIRRSNVFDPFSLDLWDPFDGFPFGSGSRSSGSIFPSFPRGTSSETAAFAGARIDWKETPEAHVFKADVPGLKKEEVKVEVEDGNVLQISGERSKEQEEKTDKWHRVERSSGKFLRRFRLPENTKPEQIKASMENGVL 140          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HS16A_WHEAT (16.9 kDa class I heat shock protein 1 OS=Triticum aestivum GN=hsp16.9A PE=2 SV=1)

HSP 1 Score: 146.362 bits (368), Expect = 8.451e-35
Identity = 75/130 (57.69%), Postives = 90/130 (69.23%), Query Frame = 3
Query:   75 SIFGNRSVFDPFSSDVWAP-----------LGSSSNEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            SI    +VFDPF+ D+WA            +   S+E + FA+A+VDWKET EAHVFK DLPG+          DG VL +SGERS EKEDKNDKWHRVER  GKFVRRFRLPE+AK+++VKA +ENGVL
Sbjct:    2 SIVRRSNVFDPFA-DLWADPFDTFRSIVPAISGGSSETAAFANARVDWKETPEAHVFKVDLPGVKKEEVKVEVEDGNVLVVSGERSREKEDKNDKWHRVERSSGKFVRRFRLPEDAKVEEVKAGLENGVL 130          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HSP11_CHERU (18.3 kDa class I heat shock protein OS=Chenopodium rubrum GN=HSP18 PE=2 SV=1)

HSP 1 Score: 145.976 bits (367), Expect = 1.104e-34
Identity = 78/141 (55.32%), Postives = 97/141 (68.79%), Query Frame = 3
Query:   60 MSLIPSIF---GNRS-VFDPFSSD-VWAPL------------GSSSNEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            MSLIP+ +   G RS +FDPFS D +W P               ++ E + FA+A++DWKET EAHVFKADLPG+          DG VL+ISG+R+ EKE+KND WHRVER  G+F+R+FRLPENAK+DQVKA MENGVL
Sbjct:    1 MSLIPNNWFNTGRRSNIFDPFSLDEIWDPFFGLPSTLSTVPRSETAAETAAFANARIDWKETPEAHVFKADLPGVKKEEVKVEVEDGNVLRISGQRAREKEEKNDTWHRVERSSGQFMRKFRLPENAKVDQVKAGMENGVL 141          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HS17A_ORYSJ (17.9 kDa class I heat shock protein OS=Oryza sativa subsp. japonica GN=HSP17.9A PE=2 SV=1)

HSP 1 Score: 145.206 bits (365), Expect = 1.883e-34
Identity = 75/139 (53.96%), Postives = 92/139 (66.19%), Query Frame = 3
Query:   75 SIFGNRSVFDPFSSDVWAPL--------GSSS------------NEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            S+    +VFDPFS D+W P         GSSS            +E + FA A++DWKET EAHVFKAD+PGL          DG +LQISGER+ E+E+K D+WHRVER  GKF+RRFRLP+NAK +Q+KASMENGVL
Sbjct:    2 SLIRRSNVFDPFSLDLWDPFDGFPFGSGGSSSGSIFPSFPRGASSETAAFAGARIDWKETPEAHVFKADVPGLKKEEVKVEVDDGNILQISGERNKEQEEKTDQWHRVERSSGKFLRRFRLPDNAKPEQIKASMENGVL 140          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HS174_ORYSJ (17.4 kDa class I heat shock protein OS=Oryza sativa subsp. japonica GN=HSP17.4 PE=2 SV=2)

HSP 1 Score: 145.206 bits (365), Expect = 1.883e-34
Identity = 75/132 (56.82%), Postives = 89/132 (67.42%), Query Frame = 3
Query:   75 SIFGNRSVFDPFSSDVWAPL-------GSSS------NEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            S+    +VFDPFS D+W P        GS S      ++ + FA A++DWKET EAHVFKAD+PGL          DG VLQISGER  E+E+K DKWHRVER  GKF+RRFRLPEN K +Q+KASMENGVL
Sbjct:    2 SMIRRSNVFDPFSLDLWDPFDGFPFGSGSGSLFPRANSDAAAFAGARIDWKETPEAHVFKADVPGLKKEEVKVEVEDGNVLQISGERIKEQEEKTDKWHRVERSSGKFLRRFRLPENTKPEQIKASMENGVL 133          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HS177_ORYSJ (17.7 kDa class I heat shock protein OS=Oryza sativa subsp. japonica GN=HSP17.7 PE=2 SV=1)

HSP 1 Score: 144.05 bits (362), Expect = 4.194e-34
Identity = 74/137 (54.01%), Postives = 91/137 (66.42%), Query Frame = 3
Query:   75 SIFGNRSVFDPFSSDVWAPL--------GSSSN----------EVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            S+    + FDPFS D+W P+        GSSS+          + + FA A++DWKET E HVFKAD+PGL          DG +LQISGERS E+E+K+DKWHRVER  GKF+RRFRLPEN K +Q+KASMENGVL
Sbjct:    2 SLIRRGNAFDPFSLDLWDPVDGFPFGSGGSSSSSGSLFPRANSDAAAFAGARIDWKETPEVHVFKADVPGLKKEEVKVEVDDGNILQISGERSREQEEKSDKWHRVERSSGKFLRRFRLPENTKPEQIKASMENGVL 138          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HS16B_WHEAT (16.9 kDa class I heat shock protein 2 OS=Triticum aestivum GN=hsp16.9B PE=1 SV=1)

HSP 1 Score: 140.584 bits (353), Expect = 4.637e-33
Identity = 72/130 (55.38%), Postives = 89/130 (68.46%), Query Frame = 3
Query:   75 SIFGNRSVFDPFSSDVWAP-----------LGSSSNEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            SI    +VFDPF+ D+WA            +    +E + FA+A++DWKET EAHVFKADLPG+          DG VL +SGER+ EKEDKNDKWHRVER  GKFVRRFRL E+AK+++VKA +ENGVL
Sbjct:    2 SIVRRTNVFDPFA-DLWADPFDTFRSIVPAISGGGSETAAFANARMDWKETPEAHVFKADLPGVKKEEVKVEVEDGNVLVVSGERTKEKEDKNDKWHRVERSSGKFVRRFRLLEDAKVEEVKAGLENGVL 130          
The following BLAST results are available for this feature:
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 50
Match NameE-valueIdentityDescription
HSP11_MEDSA1.540e-3665.5718.1 kDa class I heat shock protein (Fragment) OS=... [more]
HSP11_HELAN4.481e-3657.2517.6 kDa class I heat shock protein OS=Helianthus ... [more]
HS16C_ORYSJ3.793e-3558.5916.9 kDa class I heat shock protein 3 OS=Oryza sat... [more]
HS181_ORYSJ6.471e-3553.9618.1 kDa class I heat shock protein OS=Oryza sativ... [more]
HS16A_WHEAT8.451e-3557.6916.9 kDa class I heat shock protein 1 OS=Triticum ... [more]
HSP11_CHERU1.104e-3455.3218.3 kDa class I heat shock protein OS=Chenopodium... [more]
HS17A_ORYSJ1.883e-3453.9617.9 kDa class I heat shock protein OS=Oryza sativ... [more]
HS174_ORYSJ1.883e-3456.8217.4 kDa class I heat shock protein OS=Oryza sativ... [more]
HS177_ORYSJ4.194e-3454.0117.7 kDa class I heat shock protein OS=Oryza sativ... [more]
HS16B_WHEAT4.637e-3355.3816.9 kDa class I heat shock protein 2 OS=Triticum ... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionUSDA-FP_00212 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00212 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623121 ID=BQ623121|Name=BQ623121|organism=Citrus sinensis|type=EST|length=542bp
CAATTGATAAATAAGCAAACGCTTTCGAAGAAAGTGCTCGTCGCTTTGAT
TAAGCAAAAATGTCTTTGATTCCATCTATATTCGGAAACAGGAGCGTGTT
CGACCCATTTTCCTCGGACGTCTGGGCGCCCCTTGGCTCCTCCAGCAACG
AGGTGTCAACATTCGCCAGTGCTCAAGTCGATTGGAAAGAAACCCGGGAA
GCTCATGTTTTCAAGGCGGATCTTCCGGGGCTCAAGAAAGAGGAAGTGAA
GGTTGAAGTTGAGGACGGGAGAGTCCTTCAGATCAGCGGTGAGAGGAGCG
TCGAGAAGGAAGACAAGAACGACAAATGGCACCGTGTTGAGAGGGGCCGC
GGCAAGTTCGTGAGGAGGTTCCGGTTGCCTGAGAATGCCAAGATCGATCA
AGTTAAGGCATCAATGGAGAATGGTGTCCTCACCGTCACTGTTCCCAAAG
TGGAGGAGAAGAAGCCTGAGGTCAAAATCCATTTCAGATCACCTGGTTGA
AACTCTCCGTTAATTGCAGCCTTTTTAATTTGGTTCTTGTTT
back to top