DN617298

Overview
NameDN617298
Unique NameDN617298
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length696
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9861 contig Csv1_Contig9861:1101..1793. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of DN617298 vs. ExPASy Swiss-Prot
Match: TBA3_HORVU (Tubulin alpha-3 chain OS=Hordeum vulgare GN=TUBA3 PE=2 SV=1)

HSP 1 Score: 67.781 bits (164), Expect = 6.359e-11
Identity = 32/89 (35.96%), Postives = 49/89 (55.06%), Query Frame = -3
Query:  452 WIPNNVKSSVCDIPPR--------GLSMASTFIGNSTSIQEMFRRVSEQFTAMFRRKAFLHWYTGEGMDEMEFTEAESNMNDLVSEYQQ 694
            W P   K  +   PP          +  A   I NSTS+ E+F R+  +F  M+ ++AF+HWY GEGM+E EF+EA  ++  L  +Y++
Sbjct:  346 WCPTGFKCGINYQPPSVVPGGDLAKVQRAVCMISNSTSVVEVFSRIDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDLAALEKDYEE 434          
BLAST of DN617298 vs. ExPASy Swiss-Prot
Match: TBA2_STYLE (Tubulin alpha-2 chain OS=Stylonychia lemnae PE=3 SV=1)

HSP 1 Score: 67.781 bits (164), Expect = 6.359e-11
Identity = 34/95 (35.79%), Postives = 51/95 (53.68%), Query Frame = -3
Query:  434 WIPNNVKSSVCDIPPR--------GLSMASTFIGNSTSIQEMFRRVSEQFTAMFRRKAFLHWYTGEGMDEMEFTEAESNMNDLVSEYQQYQDATA 694
            W P   K  +   PP          +  A   I NST+I E+F R+  +F  M+ ++AF+HWY GEGM+E EF+EA  ++  L  +Y++    TA
Sbjct:  345 WCPTGFKCGINYQPPTVVPSGDLAKVMRAVCMISNSTAIAEVFSRIDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDLAALEKDYEEVGIETA 439          
BLAST of DN617298 vs. ExPASy Swiss-Prot
Match: TBA2_MAIZE (Tubulin alpha-2 chain OS=Zea mays GN=TUBA2 PE=3 SV=1)

HSP 1 Score: 67.781 bits (164), Expect = 6.359e-11
Identity = 32/89 (35.96%), Postives = 49/89 (55.06%), Query Frame = -3
Query:  452 WIPNNVKSSVCDIPPR--------GLSMASTFIGNSTSIQEMFRRVSEQFTAMFRRKAFLHWYTGEGMDEMEFTEAESNMNDLVSEYQQ 694
            W P   K  +   PP          +  A   I NSTS+ E+F R+  +F  M+ ++AF+HWY GEGM+E EF+EA  ++  L  +Y++
Sbjct:  346 WCPTGFKCGINYQPPSVVPGGDLAKVQRAVCMISNSTSVVEVFSRIDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDLAALEKDYEE 434          
BLAST of DN617298 vs. ExPASy Swiss-Prot
Match: TBA2_HORVU (Tubulin alpha-2 chain OS=Hordeum vulgare GN=TUBA2 PE=2 SV=1)

HSP 1 Score: 67.781 bits (164), Expect = 6.359e-11
Identity = 32/89 (35.96%), Postives = 49/89 (55.06%), Query Frame = -3
Query:  452 WIPNNVKSSVCDIPP--------RGLSMASTFIGNSTSIQEMFRRVSEQFTAMFRRKAFLHWYTGEGMDEMEFTEAESNMNDLVSEYQQ 694
            W P   K  +   PP          +  A   I NSTS+ E+F R+  +F  M+ ++AF+HWY GEGM+E EF+EA  ++  L  +Y++
Sbjct:  346 WCPTGFKCGINYQPPGVVPGGDLAKVQRAVCMISNSTSVVEVFSRIDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDLAALEKDYEE 434          
BLAST of DN617298 vs. ExPASy Swiss-Prot
Match: TBA1_MAIZE (Tubulin alpha-1 chain OS=Zea mays GN=TUBA1 PE=3 SV=1)

HSP 1 Score: 67.781 bits (164), Expect = 6.359e-11
Identity = 32/89 (35.96%), Postives = 49/89 (55.06%), Query Frame = -3
Query:  452 WIPNNVKSSVCDIPPR--------GLSMASTFIGNSTSIQEMFRRVSEQFTAMFRRKAFLHWYTGEGMDEMEFTEAESNMNDLVSEYQQ 694
            W P   K  +   PP          +  A   I NSTS+ E+F R+  +F  M+ ++AF+HWY GEGM+E EF+EA  ++  L  +Y++
Sbjct:  346 WCPTGFKCGINYQPPSVVPGGDLAKVQRAVCMISNSTSVVEVFSRIDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDLAALEKDYEE 434          
BLAST of DN617298 vs. ExPASy Swiss-Prot
Match: TBA1_ELEIN (Tubulin alpha-1 chain OS=Eleusine indica GN=TUBA1 PE=2 SV=1)

HSP 1 Score: 67.781 bits (164), Expect = 6.359e-11
Identity = 32/89 (35.96%), Postives = 49/89 (55.06%), Query Frame = -3
Query:  452 WIPNNVKSSVCDIPPR--------GLSMASTFIGNSTSIQEMFRRVSEQFTAMFRRKAFLHWYTGEGMDEMEFTEAESNMNDLVSEYQQ 694
            W P   K  +   PP          +  A   I NSTS+ E+F R+  +F  M+ ++AF+HWY GEGM+E EF+EA  ++  L  +Y++
Sbjct:  346 WCPTGFKCGINYQPPSVVPGGDLAKVQRAVCMISNSTSVVEVFSRIDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDLAALEKDYEE 434          
BLAST of DN617298 vs. ExPASy Swiss-Prot
Match: TBA_EUPOC (Tubulin alpha chain OS=Euplotes octocarinatus PE=3 SV=1)

HSP 1 Score: 67.3958 bits (163), Expect = 8.306e-11
Identity = 34/95 (35.79%), Postives = 51/95 (53.68%), Query Frame = -3
Query:  434 WIPNNVKSSVCDIPPR--------GLSMASTFIGNSTSIQEMFRRVSEQFTAMFRRKAFLHWYTGEGMDEMEFTEAESNMNDLVSEYQQYQDATA 694
            W P   K  +   PP          +  A   I NST+I E+F R+  +F  M+ ++AF+HWY GEGM+E EF+EA  ++  L  +Y++    TA
Sbjct:  346 WSPTGFKCGINYQPPTVVPGGDLAKVMRAVCMISNSTAIAEVFSRIDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDLAALEKDYEEVGIETA 440          
BLAST of DN617298 vs. ExPASy Swiss-Prot
Match: TBA_EUGGR (Tubulin alpha chain OS=Euglena gracilis GN=TUBA PE=2 SV=1)

HSP 1 Score: 67.3958 bits (163), Expect = 8.306e-11
Identity = 32/89 (35.96%), Postives = 49/89 (55.06%), Query Frame = -3
Query:  452 WIPNNVKSSVCDIPPR--------GLSMASTFIGNSTSIQEMFRRVSEQFTAMFRRKAFLHWYTGEGMDEMEFTEAESNMNDLVSEYQQ 694
            W P   K  +   PP          +  A   I NST+I E+F R+  +F  M+ ++AF+HWY GEGM+E EF+EA  ++  L  +Y++
Sbjct:  346 WCPTGFKCGINYQPPTVVPGGDLAKVQRAVCMISNSTAIAEVFARIDHKFDLMYSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDYEE 434          
The following BLAST results are available for this feature:
BLAST of DN617298 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 258
Match NameE-valueIdentityDescription
TBA3_HORVU6.359e-1135.96Tubulin alpha-3 chain OS=Hordeum vulgare GN=TUBA3 ... [more]
TBA2_STYLE6.359e-1135.79Tubulin alpha-2 chain OS=Stylonychia lemnae PE=3 S... [more]
TBA2_MAIZE6.359e-1135.96Tubulin alpha-2 chain OS=Zea mays GN=TUBA2 PE=3 SV... [more]
TBA2_HORVU6.359e-1135.96Tubulin alpha-2 chain OS=Hordeum vulgare GN=TUBA2 ... [more]
TBA1_MAIZE6.359e-1135.96Tubulin alpha-1 chain OS=Zea mays GN=TUBA1 PE=3 SV... [more]
TBA1_ELEIN6.359e-1135.96Tubulin alpha-1 chain OS=Eleusine indica GN=TUBA1 ... [more]
TBA_EUPOC8.306e-1135.79Tubulin alpha chain OS=Euplotes octocarinatus PE=3... [more]
TBA_EUGGR8.306e-1135.96Tubulin alpha chain OS=Euglena gracilis GN=TUBA PE... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionUCRCS11_01A09_r Parent Washington Navel Orange Scale-Infested Rind cDNA Library UCRCS11 Citrus sinensis cDNA clone CS_WEd0001A09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN617298 ID=DN617298|Name=DN617298|organism=Citrus sinensis|type=EST|length=696bp
TTTTTTTTTCCAAGGAAAAGAAATAGCATATCACATTATGGCATAATAGA
CAGTAACATAATAACATCATCGACCACAGAACATAAGAAGACAATGGCTA
AGGATAATAGAATACAAAAATAGATCAAATCCAGAATAGATAGCAAGGTA
AAGGTAGCACACACTACTACTTTCAAAACATGCATCCATCCTTTAATTTC
TCCATCCTCAATAGTCGATCCTCATCGATCCCATCATCCATCACTCACTT
TACTGCTACTTGATGTAAAAAACTCGAGAAAGAAAAACTATAACACATCA
TAGATCATTTTTTGCAATCCCAAGCAAGGTTGACAAAACCAGCTACACAG
ACAAATATGCATCATACACAACTTCTTCAAATATGATGCTCCAATTCTCC
CTCTTCCTCATCTTCATACTCGCCTTCCTCATCGGCGGTGGCATCCTGGT
ACTGCTGGTACTCAGACACGAGGTCATTCATATTGCTCTCAGCTTCAGTG
AACTCCATTTCATCCATCCCTTCACCAGTGTACCAGTGAAGGAAAGCCTT
TCTCCTAAACATAGCTGTGAATTGCTCACTCACTCTTCGGAACATTTCTT
GGATGGATGTTGAGTTCCCGATGAAGGTGGATGCCATGGAGAGACCTCTG
GGAGGAATGTCACAAACACTGGACTTCACATTGTTTGGAATCCACT
back to top