B-Actin, B-Actin (genetic_marker) Citrus unshiu | Citrus Genome Database

Marker Overview

Marker Overview


Name	B-Actin
Genbank ID	Z323632
Type	gene marker
Species	Citrus unshiu
Primer 1	B-Actin.Forward Primer: CACTGGAGTCATGGTTGGAA
Primer 2	B-Actin.Reverse Primer: CCGTGCTCAATTGGGTATTT
Publication	[view all]
Contact	Ken Marsh Renxue Xia

Contact

Name

Details

Ken Marsh

First name:	Ken
Last name:	Marsh
Title:	Researcher
Institution:	Mt. Albert Research Centre
Address:	Hort Research, Mt. Albert Research Centre, Private Bag 92 169, Auckland, New Zealand
Email:	kmarsh@hortresearch.co.nz
Phone:	+61 9 815 4200
Fax:	+61 9 815 4202

Renxue Xia

First name:	Renxue
Last name:	Xia
Title:	Researcher
Institution:	Huazhong Agricultural University
Address:	Key Laboratory of Horticultural Plant Biology, Ministry of Education, College of Horticulture and Forestry Science, Huazhong Agricultural University, Wuhan 430070, PR China
Country:	China
Email:	renxuexia@mail.hzau.edu.cn
Phone:	+86 27 87284181

Publications


Year	Publication
2010	Wang Y, Li J, Xia R. Expression of chalcone synthase and chalcone isomerase genes and accumulation of corresponding flavonoids during fruit maturation of Guoqing No. 4 satsuma mandarin (Citrus unshiu Marcow). Scientia horticulturae. 2010; 125(2):110-116.
2008	Ghasemnezhad M, Marsh K, Shilton R, Babalar M, Woolf A. Effect of hot water treatments on chilling injury and heat damage in 'satsuma' mandarins: Antioxidant enzymes and vacuolar ATPase, and pyrophosphatase. Postharvest biology and technology. 2008; 48(3):364-371.