|
Marker Overview
Name | EF1 |
Genbank ID | AY498567 |
Type | gene marker |
Species | Citrus clementina |
Primer 1 | EF1.Forward Primer: ATTGACAAGCGTGTGATTGAGC |
Primer 2 | EF1.Reverse Primer: TCCACAAGGCAATATCAATGGTA |
Publication | [view all] |
Contact | Alessandra Gentile
|
Publications
Year | Publication |
2009 | Distefano G, Las Casas G, Caruso M, Todaro A, Rapisarda P, La Malfa S, Gentile A, Tribulato E. Physiological and Molecular Analysis of the Maturation Process in Fruits of Clementine Mandarin and One of Its Late-Ripening Mutants. Journal of agricultural and food chemistry. 2009; 57(17):7974-7982. |
2009 | Distefano G, Caruso M, La Malfa S, Gentile A, Tribulato E. Histological and molecular analysis of pollen-pistil interaction in clementine. Plant cell reports. 2009 Sep; 28(9):1439-51. |
|